WNT9A cdna clone

WNT9A cDNA Clone

Cat. Num. AAA1276049

• Gene Names: WNT9A; WNT14
• Synonyms: WNT9A; WNT9A cDNA Clone; WNT9A cdna clone

• Sequence: ATGCTGGATGGGTCCCCGCTGGCGCGCTGGCTGGCCGCGGCCTTCGGGCTGACGCTGCTGCTCGCCGCGCTGCGCCCTTCGGCCGCCTACTTCGGGCTGACGGGCAGCGAGCCCCTGACCATCCTCCCGCTGACCCTGGAGCCAGAGGCGGCCGCCCAGGCGCACTACAAGGCCTGCGACCGGCTGAAGCTGGAGCGGAAGCAGCGGCGCATGTGCCGCCGGGACCCGGGCGTGGCAGAGACGCTGGTGGAGGCCGTGAGCATGAGTGCGCTCGAGTGCCAGTTCCAGTTCCGCTTTGAGCGCTGGAACTGCACGCTGGAGGGCCGCTACCGGGCCAGCCTGCTCAAGCGAGGCTTCAAGGAGACTGCCTTCCTCTATGCCATCTCCTCGGCTGGCCTGACGCACGCACTGGCCAAGGCGTGCAGCGCGGGCCGCATGGAGCGCTGTACCTGCGATGAGGCACCCGACCTGGAGAACCGTGAGGCCTGGCAGTGGGGGGGCTGCGGAGACAACCTTAAGTACAGCAGCAAGTTCGTCAAGGAATTCCTGGGCAGACGGTCAAGCAAGGATCTGCGAGCCCGTGTGGACTTCCACAACAACCTCGTGGGTGTGAAGGTGATCAAGGCTGGGGTGGAGACCACCTGCAAGTGCCACGGCGTGTCAGGCTCATGCACGGTGCGGACCTGCTGGCGGCAGTTGGCGCCTTTCCATGAGGTGGGCAAGCATCTGAAGCACAAGTATGAGACGGCACTCAAGGTGGGCAGCACCACCAATGAAGCTGCCGGCGAGGCAGGTGCCATCTCCCCACCACGGGGCCGTGCCTCGGGGGCAGGTGGCAGCGACCCGCTGCCCCGCACTCCAGAGCTGGTGCACCTGGATGACTCGCCTAGCTTCTGCCTGGCTGGCCGCTTCTCCCCGGGCACCGCTGGCCGTAGGTGCCACCGTGAGAAGAACTGCGAGAGCATCTGCTGTGGCCGCGGCCATAACACACAGAGCCGGGTGGTGACAAGGCCCTGCCAGTGCCAGGTGCGTTGGTGCTGCTATGTGGAGTGCAGGCAGTGCACGCAGCGTGAGGAGGTCTACACCTGCAAGGGCTGA
• Sequence Length: 1098

• Vector: Please Inquire

NCBI and Uniprot Product Information

• NCBI GI #: 109731254
• NCBI GeneID: 7483
• Molecular Weight: 40,320 Da
• NCBI Official Full Name: Homo sapiens wingless-type MMTV integration site family, member 9A, mRNA
• NCBI Official Synonym Full Names: Wnt family member 9A
• NCBI Official Symbol: WNT9A
• NCBI Official Synonym Symbols: WNT14
• NCBI Protein Information: protein Wnt-9a
• UniProt Protein Name: Protein Wnt-9a
• Protein Family: Protein
• UniProt Gene Name: WNT9A
• UniProt Synonym Gene Names: WNT14
• UniProt Entry Name: WNT9A_HUMAN

NCBI Description

The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is expressed in gastric cancer cell lines. The protein encoded by this gene shows 75% amino acid identity to chicken Wnt14, which has been shown to play a central role in initiating synovial joint formation in the chick limb. This gene is clustered with another family member, WNT3A, in the chromosome 1q42 region. [provided by RefSeq, Jul 2008]

Uniprot Description

WNT9A: Ligand for members of the frizzled family of seven transmembrane receptors. Probable developmental protein. May be a signaling molecule which affects the development of discrete regions of tissues. Is likely to signal over only few cell diameters. Belongs to the Wnt family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 1q42

Cellular Component: extracellular region; extracellular space

Molecular Function: frizzled binding

Biological Process: cell fate commitment; mitotic cell cycle checkpoint; negative regulation of cell proliferation; negative regulation of chondrocyte differentiation; neuron differentiation; Wnt receptor signaling pathway