Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WNT7B cdna clone

WNT7B cDNA Clone

Synonyms
WNT7B; WNT7B cDNA Clone; WNT7B cdna clone
Ordering
For Research Use Only!
Sequence
atgcacagaaactttcgcaagtggattttctacgtgtttctctgctttggcgtcctgtacgtgaagctcggagcactgtcatccgtggtggccctgggagccaacatcatctgcaacaagattcctggcctagccccgcggcagcgtgccatctgccagagtcggcccgatgccatcattgtgattggggagggggcgcagatgggcatcaacgagtgccagtaccagttccgcttcggacgctggaactgctctgccctcggcgagaagaccgtcttcgggcaagagctccgagtagggagccgtgaggctgccttcacgtacgccatcaccgcggctggcgtggcgcacgccgtcaccgctgcctgcagccaagggaacctgagcaactgcggctgcgaccgcgagaagcagggctactacaaccaagccgagggctggaagtggggcggctgctcggccgacgtgcgttacggcatcgacttctcccggcgcttcgtggacgctcgggagatcaagaagaacgcgcggcgcctcatgaacctgcataacaatgaggccggcaggaaggttctagaggaccggatgcagctggagtgcaagtgccacggcgtgtctggctcctgcaccaccaaaacctgctggaccacgctgcccaagttccgagaggtgggccacctgctgaaggagaagtacaacgcggccgtgcaggtggaggtggtgcgggccagccgtctgcggcagcccaccttcctgcgcatcaaacagctgcgcagctatcagaagcccatggagacagacctggtgtacattgagaagtcgcccaactactgcgaggaggacgcggccacgggcagcgtgggcacgcagggccgtctctgcaaccgcacgtcgcccggcgcggacggctgtgacaccatgtgctgcggccgaggctacaacacccaccagtacaccaaggtgtggcagtgcaactgcaaattccactggtgctgcttcgtcaagtgcaacacctgcagcgagcgcaccgaggtcttcacctgcaagtga
Sequence Length
1050
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,327 Da
NCBI Official Full Name
Homo sapiens wingless-type MMTV integration site family, member 7B, mRNA
NCBI Official Synonym Full Names
Wnt family member 7B
NCBI Official Symbol
WNT7B
NCBI Protein Information
protein Wnt-7b
UniProt Protein Name
Protein Wnt-7b
Protein Family
UniProt Gene Name
WNT7B
UniProt Entry Name
WNT7B_HUMAN

NCBI Description

This gene is a member of the WNT gene family, which consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Among members of the human WNT family, this gene product is most similar to WNT7A protein. [provided by RefSeq, Oct 2008]

Uniprot Description

WNT7B: Ligand for members of the frizzled family of seven transmembrane receptors. Probable developmental protein. May be a signaling molecule which affects the development of discrete regions of tissues. Is likely to signal over only few cell diameters. Belongs to the Wnt family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 22q13

Cellular Component: endoplasmic reticulum lumen; extracellular region; extracellular space; Golgi lumen; plasma membrane

Molecular Function: frizzled binding

Biological Process: cell fate commitment; cellular metabolic process; central nervous system vasculogenesis; embryonic organ development; establishment and/or maintenance of polarity of embryonic epithelium; fibroblast proliferation; forebrain regionalization; homeostatic process; in utero embryonic development; lung development; neuron differentiation; oxygen homeostasis; positive regulation of osteoblast differentiation; synapse organization and biogenesis; Wnt receptor signaling pathway; Wnt receptor signaling pathway through beta-catenin

Research Articles on WNT7B

Similar Products

Product Notes

The WNT7B wnt7b (Catalog #AAA1275667) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcacagaa actttcgcaa gtggattttc tacgtgtttc tctgctttgg cgtcctgtac gtgaagctcg gagcactgtc atccgtggtg gccctgggag ccaacatcat ctgcaacaag attcctggcc tagccccgcg gcagcgtgcc atctgccaga gtcggcccga tgccatcatt gtgattgggg agggggcgca gatgggcatc aacgagtgcc agtaccagtt ccgcttcgga cgctggaact gctctgccct cggcgagaag accgtcttcg ggcaagagct ccgagtaggg agccgtgagg ctgccttcac gtacgccatc accgcggctg gcgtggcgca cgccgtcacc gctgcctgca gccaagggaa cctgagcaac tgcggctgcg accgcgagaa gcagggctac tacaaccaag ccgagggctg gaagtggggc ggctgctcgg ccgacgtgcg ttacggcatc gacttctccc ggcgcttcgt ggacgctcgg gagatcaaga agaacgcgcg gcgcctcatg aacctgcata acaatgaggc cggcaggaag gttctagagg accggatgca gctggagtgc aagtgccacg gcgtgtctgg ctcctgcacc accaaaacct gctggaccac gctgcccaag ttccgagagg tgggccacct gctgaaggag aagtacaacg cggccgtgca ggtggaggtg gtgcgggcca gccgtctgcg gcagcccacc ttcctgcgca tcaaacagct gcgcagctat cagaagccca tggagacaga cctggtgtac attgagaagt cgcccaacta ctgcgaggag gacgcggcca cgggcagcgt gggcacgcag ggccgtctct gcaaccgcac gtcgcccggc gcggacggct gtgacaccat gtgctgcggc cgaggctaca acacccacca gtacaccaag gtgtggcagt gcaactgcaa attccactgg tgctgcttcg tcaagtgcaa cacctgcagc gagcgcaccg aggtcttcac ctgcaagtga. It is sometimes possible for the material contained within the vial of "WNT7B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.