Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WNT5B cdna clone

WNT5B cDNA Clone

Synonyms
WNT5B; WNT5B cDNA Clone; WNT5B cdna clone
Ordering
For Research Use Only!
Sequence
atgcccagcctgctgctgctgttcacggctgctctgctgtccagctgggctcagcttctgacagacgccaactcctggtggtcattagctttgaacccggtgcagagacccgagatgtttatcatcggtgcccagcccgtgtgcagtcagcttcccgggctctcccctggccagaggaagctgtgccaattgtaccaggagcacatggcctacataggggagggagccaagactggcatcaaggaatgccagcaccagttccggcagcggcggtggaattgcagcacagcggacaacgcatctgtctttgggagagtcatgcagataggcagccgagagaccgccttcacccacgcggtgagcgccgcgggcgtggtcaacgccatcagccgggcctgccgcgagggcgagctctccacctgcggctgcagccggacggcgcggcccaaggacctgccccgggactggctgtggggcggctgtggggacaacgtggagtacggctaccgcttcgccaaggagtttgtggatgcccgggagcgagagaagaactttgccaaaggatcagaggagcagggccgggtgctcatgaacctgcaaaacaacgaggccggtcgcagggctgtgtataagatggcagacgtagcctgcaaatgccacggcgtctcggggtcctgcagcctcaagacctgctggctgcagctggccgagttccgcaaggtcggggaccggctgaaggagaagtacgacagcgcggccgccatgcgcgtcacccgcaagggccggctggagctggtcaacagccgcttcacccagcccaccccggaggacctggtctatgtggaccccagccccgactactgcctgcgcaacgagagcacgggctccctgggcacgcagggccgcctctgcaacaagacctcggagggcatggatggctgtgagctcatgtgctgcgggcgtggctacaaccagttcaagagcgtgcaggtggagcgctgccactgcaagttccactggtgctgcttcgtcaggtgtaagaagtgcacggagatcgtggaccagtacatctgtaaatag
Sequence Length
1080
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,323 Da
NCBI Official Full Name
Homo sapiens wingless-type MMTV integration site family, member 5B, mRNA
NCBI Official Synonym Full Names
Wnt family member 5B
NCBI Official Symbol
WNT5B
NCBI Protein Information
protein Wnt-5b
UniProt Protein Name
Protein Wnt-5b
UniProt Gene Name
WNT5B
UniProt Entry Name
WNT5B_HUMAN

NCBI Description

The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 94% and 80% amino acid identity to the mouse Wnt5b protein and the human WNT5A protein, respectively. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]

Uniprot Description

WNT5B: Ligand for members of the frizzled family of seven transmembrane receptors. Probable developmental protein. May be a signaling molecule which affects the development of discrete regions of tissues. Is likely to signal over only few cell diameters. Interacts with PORCN. Belongs to the Wnt family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 12p13.3

Cellular Component: endoplasmic reticulum lumen; extracellular region; extracellular space; Golgi lumen; plasma membrane

Molecular Function: frizzled binding; receptor binding

Biological Process: cell fate commitment; chondrocyte differentiation; neuron differentiation; positive regulation of cell migration; Wnt receptor signaling pathway

Research Articles on WNT5B

Similar Products

Product Notes

The WNT5B wnt5b (Catalog #AAA1274176) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccagcc tgctgctgct gttcacggct gctctgctgt ccagctgggc tcagcttctg acagacgcca actcctggtg gtcattagct ttgaacccgg tgcagagacc cgagatgttt atcatcggtg cccagcccgt gtgcagtcag cttcccgggc tctcccctgg ccagaggaag ctgtgccaat tgtaccagga gcacatggcc tacatagggg agggagccaa gactggcatc aaggaatgcc agcaccagtt ccggcagcgg cggtggaatt gcagcacagc ggacaacgca tctgtctttg ggagagtcat gcagataggc agccgagaga ccgccttcac ccacgcggtg agcgccgcgg gcgtggtcaa cgccatcagc cgggcctgcc gcgagggcga gctctccacc tgcggctgca gccggacggc gcggcccaag gacctgcccc gggactggct gtggggcggc tgtggggaca acgtggagta cggctaccgc ttcgccaagg agtttgtgga tgcccgggag cgagagaaga actttgccaa aggatcagag gagcagggcc gggtgctcat gaacctgcaa aacaacgagg ccggtcgcag ggctgtgtat aagatggcag acgtagcctg caaatgccac ggcgtctcgg ggtcctgcag cctcaagacc tgctggctgc agctggccga gttccgcaag gtcggggacc ggctgaagga gaagtacgac agcgcggccg ccatgcgcgt cacccgcaag ggccggctgg agctggtcaa cagccgcttc acccagccca ccccggagga cctggtctat gtggacccca gccccgacta ctgcctgcgc aacgagagca cgggctccct gggcacgcag ggccgcctct gcaacaagac ctcggagggc atggatggct gtgagctcat gtgctgcggg cgtggctaca accagttcaa gagcgtgcag gtggagcgct gccactgcaa gttccactgg tgctgcttcg tcaggtgtaa gaagtgcacg gagatcgtgg accagtacat ctgtaaatag. It is sometimes possible for the material contained within the vial of "WNT5B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.