Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WNT5A cdna clone

WNT5A cDNA Clone

Gene Names
WNT5A; hWNT5A
Synonyms
WNT5A; WNT5A cDNA Clone; WNT5A cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaagtccattggaatattaagcccaggagttgctttggggatggctggaagtgcaatgtcttccaagttcttcctagtggctttggccatatttttctccttcgcccaggttgtaattgaagccaattcttggtggtcgctaggtatgaataaccctgttcagatgtcagaagtatatattataggagcacagcctctctgcagccaactggcaggactttctcaaggacagaagaaactgtgccacttgtatcaggaccacatgcagtacatcggagaaggcgcgaagacaggcatcaaagaatgccagtatcaattccgacatcgaaggtggaactgcagcactgtggataacacctctgtttttggcagggtgatgcagataggcagccgcgagacggccttcacatacgcggtgagcgcagcaggggtggtgaacgccatgagccgggcgtgccgcgagggcgagctgtccacctgcggctgcagccgcgccgcgcgccccaaggacctgccgcgggactggctctggggcggctgcggcgacaacatcgactatggctaccgctttgccaaggagttcgtggacgcccgcgagcgggagcgcatccacgccaagggctcctacgagagtgctcgcatcctcatgaacctgcacaacaacgaggccggccgcaggacggtgtacaacctggctgatgtggcctgcaagtgccatggggtgtccggctcatgtagcctgaagacatgctggctgcagctggcagacttccgcaaggtgggtgatgccctgaaggagaagtacgacagcgcggcggccatgcggctcaacagccggggcaagttggtacaggtcaacagccgcttcaactcgcccaccacacaagacctggtctacatcgaccccagccctgactactgcgtgcgcaatgagagcaccggctcgctgggcacgcagggccgcctgtgcaacaagacgtcggagggcatggatggctgcgagctcatgtgctgcggccgtggctacgaccagttcaagaccgtgcagacggagcgctgccactgcaagttccactggtgctgctacgtcaagtgcaagaagtgcacggagatcgtggaccagtttgtgtgcaagtag
Sequence Length
1143
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,887 Da
NCBI Official Full Name
Homo sapiens wingless-type MMTV integration site family, member 5A, mRNA
NCBI Official Synonym Full Names
Wnt family member 5A
NCBI Official Symbol
WNT5A
NCBI Official Synonym Symbols
hWNT5A
NCBI Protein Information
protein Wnt-5a
UniProt Protein Name
Protein Wnt-5a
Protein Family
UniProt Gene Name
WNT5A
UniProt Entry Name
WNT5A_HUMAN

NCBI Description

The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]

Uniprot Description

WNT5A: Ligand for members of the frizzled family of seven transmembrane receptors. Can activate or inhibit canonical Wnt signaling, depending on receptor context. In the presence of FZD4, activates beta-catenin signaling. In the presence of ROR2, inhibits the canonical Wnt pathway by promoting beta-catenin degradation through a GSK3-independent pathway which involves down-regulation of beta-catenin-induced reporter gene expression. Suppression of the canonical pathway allows chondrogenesis to occur and inhibits tumor formation. Stimulates cell migration. Decreases proliferation, migration, invasiveness and clonogenicity of carcinoma cells and may act as a tumor suppressor. Mediates motility of melanoma cells. Required during embryogenesis for extension of the primary anterior-posterior axis and for outgrowth of limbs and the genital tubercle. Inhibits type II collagen expression in chondrocytes. Interacts with PORCN. Interacts with WLS. Expression is increased in differentiated thyroid carcinomas compared to normal thyroid tissue and anaplastic thyroid tumors where expression is low or undetectable. Expression is found in thyrocytes but not in stromal cells. Belongs to the Wnt family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 3p21-p14

Cellular Component: endoplasmic reticulum lumen; extracellular region; extracellular space; Golgi lumen; plasma membrane

Molecular Function: frizzled binding; protein binding; receptor agonist activity; receptor tyrosine kinase-like orphan receptor binding; transcription factor activity

Biological Process: activation of JNK activity; activation of MAPK activity; activation of NF-kappaB transcription factor; activation of protein kinase B; axon guidance; cell fate commitment; embryonic skeletal development; epithelial to mesenchymal transition; genitalia development; keratinocyte differentiation; lens development in camera-type eye; male gonad development; negative regulation of apoptosis; negative regulation of fat cell differentiation; negative regulation of transcription, DNA-dependent; neuron differentiation; olfactory bulb interneuron development; palate development; positive regulation of angiogenesis; positive regulation of cGMP metabolic process; positive regulation of chemokine biosynthetic process; positive regulation of cytokine secretion during immune response; positive regulation of endothelial cell proliferation; positive regulation of fibroblast proliferation; positive regulation of inflammatory response; positive regulation of interleukin-1 beta secretion; positive regulation of interleukin-6 production; positive regulation of macrophage activation; positive regulation of ossification; positive regulation of protein catabolic process; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; response to organic substance; synaptogenesis; Wnt receptor signaling pathway; Wnt receptor signaling pathway, calcium modulating pathway; Wnt receptor signaling pathway, planar cell polarity pathway; wound healing

Disease: Robinow Syndrome, Autosomal Dominant

Research Articles on WNT5A

Similar Products

Product Notes

The WNT5A wnt5a (Catalog #AAA1271454) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaagt ccattggaat attaagccca ggagttgctt tggggatggc tggaagtgca atgtcttcca agttcttcct agtggctttg gccatatttt tctccttcgc ccaggttgta attgaagcca attcttggtg gtcgctaggt atgaataacc ctgttcagat gtcagaagta tatattatag gagcacagcc tctctgcagc caactggcag gactttctca aggacagaag aaactgtgcc acttgtatca ggaccacatg cagtacatcg gagaaggcgc gaagacaggc atcaaagaat gccagtatca attccgacat cgaaggtgga actgcagcac tgtggataac acctctgttt ttggcagggt gatgcagata ggcagccgcg agacggcctt cacatacgcg gtgagcgcag caggggtggt gaacgccatg agccgggcgt gccgcgaggg cgagctgtcc acctgcggct gcagccgcgc cgcgcgcccc aaggacctgc cgcgggactg gctctggggc ggctgcggcg acaacatcga ctatggctac cgctttgcca aggagttcgt ggacgcccgc gagcgggagc gcatccacgc caagggctcc tacgagagtg ctcgcatcct catgaacctg cacaacaacg aggccggccg caggacggtg tacaacctgg ctgatgtggc ctgcaagtgc catggggtgt ccggctcatg tagcctgaag acatgctggc tgcagctggc agacttccgc aaggtgggtg atgccctgaa ggagaagtac gacagcgcgg cggccatgcg gctcaacagc cggggcaagt tggtacaggt caacagccgc ttcaactcgc ccaccacaca agacctggtc tacatcgacc ccagccctga ctactgcgtg cgcaatgaga gcaccggctc gctgggcacg cagggccgcc tgtgcaacaa gacgtcggag ggcatggatg gctgcgagct catgtgctgc ggccgtggct acgaccagtt caagaccgtg cagacggagc gctgccactg caagttccac tggtgctgct acgtcaagtg caagaagtgc acggagatcg tggaccagtt tgtgtgcaag tag. It is sometimes possible for the material contained within the vial of "WNT5A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.