Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WHSC1L1 cdna clone

WHSC1L1 cDNA Clone

Gene Names
WHSC1L1; NSD3; WHISTLE; pp14328
Synonyms
WHSC1L1; WHSC1L1 cDNA Clone; WHSC1L1 cdna clone
Ordering
For Research Use Only!
Sequence
atggatttctctttctctttcatgcaagggatcatgggaaacacaattcagcaaccacctcaactcattgactccgccaacatccgtcaggaggatgcctttgataacaacagtgacattgctgaagatggtggccagacaccatatgaagctactttgcagcaaggctttcagtacccagctacaacagaagatcttcctccactcacaaatgggtatccatcatcaatcagtgtgtatgaaactcaaaccaaataccagtcatataatcagtatcctaatgggtcagccaatggctttggtgcagttagaaactttagccccactgactattatcattcagaaattccaaacacaagaccacatgaaattctggaaaaaccttcccctccacagccaccacctcctccttcggtaccacaaactgtgattccaaagaagactggctcacctgaaattaaactaaaaataaccaaaactatccagaatggcagggaattgtttgagtcttccctttgtggagaccttttaaatgaagtacaggcaagtgagcacacgaaatcaaagcatgaaagcagaaaagaaaagaggaaaaaaagcaacaagcatgactcatcaagatctgaagagcgcaagtcacacaaaatccccaaattagaaccagaggaacaaaatagaccaaatgagagggttgacactgtatcagaaaaaccaagggaagaaccagtactaaaagaggaagccccagttcagccaatactatcttctgttccaacaacggaagtgtccactggtgttaagtttcaggttggcgatcttgtgtggtccaaggtgggaacctatccttggtggccttgtatggtttcaagtgatccccagcttgaggttcatactaaaattaacacaagaggtgcccgagaatatcatgtccagttttttagcaaccagccagagagggcgtgggttcatgaaaaacgggtacgagagtataaaggtcataaacagtatgaagaattactggctgaggcaaccaaacaagccagcaatcactctgagaaacaaaagattcggaaaccccgacctcagagagaacgtgctcagtgggatattggcattgcccatgcagagaaagcattgaaaatgactcgagaagaaagaatagaacagtatacttttatttacattgataaacagcctgaagaggctttatcccaagcaaaaaagagtgttgcctccaaaaccgaagttaaaaaaacccgacgaccaagatctgtgctgaatactcagccagaacagaccaatgcaggggaggtggcctcctcactctcaagtactgaaattcggagacatagccagaggcggcacacaagtgcggaagaggaagagccaccgcctgttaaaatagcctggaaaactgcggcagcaaggaaatccttaccagcttccattacgatgcacaaagggagcctggatttgcagaagtgtaacatgtctccagttgtgaaaattgaacaagtgtttgctcttcagaatgctacaggggatgggaaatttatcgatcaatttgtttattcaacaaagggaattggtaacaaaacagaaataagtgtcagggggcaagacaggcttataatttctacaccaaaccagagaaatgaaaagccaacgcagagtgtatcatctcctgaagcaacatctggttctacaggctcagtagaaaagaagcaacagagaagatcaattagaactcgttctgaatcagagaaatccactgaggttgtgccaaagaagaagatcaaaaaggagcaggttgaaacagttcctcaggctacagtgaagactggattacagaaagggtcggcggaccggggagtgcagggctctgtcagattcagtgacagctccgtctccgcagcgattgaggaaactgtggactga
Sequence Length
1938
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
160,314 Da
NCBI Official Full Name
Homo sapiens Wolf-Hirschhorn syndrome candidate 1-like 1, mRNA
NCBI Official Synonym Full Names
Wolf-Hirschhorn syndrome candidate 1-like 1
NCBI Official Symbol
WHSC1L1
NCBI Official Synonym Symbols
NSD3; WHISTLE; pp14328
NCBI Protein Information
histone-lysine N-methyltransferase NSD3
UniProt Protein Name
Histone-lysine N-methyltransferase NSD3
UniProt Gene Name
WHSC1L1
UniProt Synonym Gene Names
NSD3; WHSC1-like protein 1
UniProt Entry Name
NSD3_HUMAN

NCBI Description

This gene is related to the Wolf-Hirschhorn syndrome candidate-1 gene and encodes a protein with PWWP (proline-tryptophan-tryptophan-proline) domains. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. Two alternatively spliced variants have been described. [provided by RefSeq, May 2015]

Uniprot Description

WHSC1L1: is related to the Wolf-Hirschhorn syndrome candidate-1 protein containing PWWP (proline-tryptophan-tryptophan-proline) domains. The function of the protein has not been determined. Two alternatively spliced isoforms have been described.

Protein type: Oncoprotein; Methyltransferase, protein lysine; Histone-binding; Amino Acid Metabolism - lysine degradation; Methyltransferase; EC 2.1.1.43

Chromosomal Location of Human Ortholog: 8p11.2

Cellular Component: nucleoplasm; nucleus

Molecular Function: histone-lysine N-methyltransferase activity; protein binding

Biological Process: histone methylation

Disease: Leukemia, Acute Myeloid

Research Articles on WHSC1L1

Similar Products

Product Notes

The WHSC1L1 whsc1l1 (Catalog #AAA1276111) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatttct ctttctcttt catgcaaggg atcatgggaa acacaattca gcaaccacct caactcattg actccgccaa catccgtcag gaggatgcct ttgataacaa cagtgacatt gctgaagatg gtggccagac accatatgaa gctactttgc agcaaggctt tcagtaccca gctacaacag aagatcttcc tccactcaca aatgggtatc catcatcaat cagtgtgtat gaaactcaaa ccaaatacca gtcatataat cagtatccta atgggtcagc caatggcttt ggtgcagtta gaaactttag ccccactgac tattatcatt cagaaattcc aaacacaaga ccacatgaaa ttctggaaaa accttcccct ccacagccac cacctcctcc ttcggtacca caaactgtga ttccaaagaa gactggctca cctgaaatta aactaaaaat aaccaaaact atccagaatg gcagggaatt gtttgagtct tccctttgtg gagacctttt aaatgaagta caggcaagtg agcacacgaa atcaaagcat gaaagcagaa aagaaaagag gaaaaaaagc aacaagcatg actcatcaag atctgaagag cgcaagtcac acaaaatccc caaattagaa ccagaggaac aaaatagacc aaatgagagg gttgacactg tatcagaaaa accaagggaa gaaccagtac taaaagagga agccccagtt cagccaatac tatcttctgt tccaacaacg gaagtgtcca ctggtgttaa gtttcaggtt ggcgatcttg tgtggtccaa ggtgggaacc tatccttggt ggccttgtat ggtttcaagt gatccccagc ttgaggttca tactaaaatt aacacaagag gtgcccgaga atatcatgtc cagtttttta gcaaccagcc agagagggcg tgggttcatg aaaaacgggt acgagagtat aaaggtcata aacagtatga agaattactg gctgaggcaa ccaaacaagc cagcaatcac tctgagaaac aaaagattcg gaaaccccga cctcagagag aacgtgctca gtgggatatt ggcattgccc atgcagagaa agcattgaaa atgactcgag aagaaagaat agaacagtat acttttattt acattgataa acagcctgaa gaggctttat cccaagcaaa aaagagtgtt gcctccaaaa ccgaagttaa aaaaacccga cgaccaagat ctgtgctgaa tactcagcca gaacagacca atgcagggga ggtggcctcc tcactctcaa gtactgaaat tcggagacat agccagaggc ggcacacaag tgcggaagag gaagagccac cgcctgttaa aatagcctgg aaaactgcgg cagcaaggaa atccttacca gcttccatta cgatgcacaa agggagcctg gatttgcaga agtgtaacat gtctccagtt gtgaaaattg aacaagtgtt tgctcttcag aatgctacag gggatgggaa atttatcgat caatttgttt attcaacaaa gggaattggt aacaaaacag aaataagtgt cagggggcaa gacaggctta taatttctac accaaaccag agaaatgaaa agccaacgca gagtgtatca tctcctgaag caacatctgg ttctacaggc tcagtagaaa agaagcaaca gagaagatca attagaactc gttctgaatc agagaaatcc actgaggttg tgccaaagaa gaagatcaaa aaggagcagg ttgaaacagt tcctcaggct acagtgaaga ctggattaca gaaagggtcg gcggaccggg gagtgcaggg ctctgtcaga ttcagtgaca gctccgtctc cgcagcgatt gaggaaactg tggactga. It is sometimes possible for the material contained within the vial of "WHSC1L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.