Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WFS1 cdna clone

WFS1 cDNA Clone

Gene Names
WFS1; WFS; WFRS; WFSL; CTRCT41
Synonyms
WFS1; WFS1 cDNA Clone; WFS1 cdna clone
Ordering
For Research Use Only!
Sequence
atggactccaacactgctccgctgggcccctcctgcccacagcccccgccagcaccgcagccccaggcgcgttcccgactcaatgccacagcctcgttggagcaggagaggagcgaaaggccccgagcacccggaccccaggctggccctggccctggtgttagagacgcagcggcccccgctgaaccccaggcccagcataccaggagccgggaaagagcagacggcaccgggcctacaaagggagacatggaaatcccctttgaagaagtcctggagagggccaaggccggggaccccaaggcacagactgaggtggggaagcactacctgcagttggccggcgacacggatgaagaactcaacagctgcaccgctgtggactggctggtcctcgccgcgaagcagggccgtcgcgaggctgtgaagctgcttcgccggtgcttggcggacagaagaggcatcacgtccgagaacgaacgggaggtgaggcagctctcctccgagaccgacctggagagggccgtgcgcaaggcagccctggtcatgtactggaagctcaaccccaagaagaagaagcaggtggccgtggcggagctgctggagaatgtcggccaggtcaacgagcacgatggaggggcgcagccaggccccgtgcccaagtccctgcagaagcagaggcgcatgctggagcgcctggtcagcagcgagtccaagaactacatcgcgctggatgactttgtggagatcactaagaagtacgccaagggcgtcatccccagcagcctgttcctgcaggacgacgaagatgatgacgagctggcggggaagagccctgaggacctgccactgcgtctgaaggtggtcaagtaccccctgcacgccatcatggagatcaaggagtacctgattgacatggcctccagggcaggcatgcactggctgtccaccatcatccccacgcaccacatcaacgcgctcatcttcttcttcatcgtcagcaacctcaccatcgacttcttcgccttcttcatcccgctggtcatcttctacctgtccttcatctccatggtgatctgcaccctcaaggtgttccaggacagcaaggcctgggagaacttccgcaccctcaccgacctgctgctgcgcttcgagcccaacctggatgtggagcaggccgaggtcaacttcggctggaaccacctggagccctatgcccatttcctgctctctgtcttcttcgtcatcttctccttccccatcgccagcaaggactgcatcccctgctcggagctggctgtcatcaccggcttctttaccgtgaccagctacctgagcctgagcacccatgcagagccctacacgcgcagggccctggccaccgaggtcaccgccggcctgctatcgctgctgccctccatgcccttgaattggccctacctgaaggtccttggccagaccttcatcaccgtgcctgtcggccacctggtcgtcctcaacgtcagcgtcccgtgcctgctctatgtctacctgctctatctcttcttccgcatggcacagctgaggaatttcaagggcacctactgctaccttgtgccctacctggtgtgcttcatgtggtgtgagctctccgtggtcatcctgctggagtccaccggcctggggctgctccgcgcctccatcggctacttcctcttcctctttgccctccccatcctggtggccggcctggccctggtgggcgtgctgcagttcgcccggtggttcacgtctctggagctcaccaagatcgcagtcaccgtggcggtctgtagtgtgcccctgctgttgcgctggtggaccaaggccagcttctctgtggtggggatggtgaagtccctgacgcggagctccatggtcaagctcatcctggtgtggctcacggccatcgtgctgttctgctggttctatgtgtaccgctcagagggcatgaaggtctacaactccacactgacctggcagcagtatggtgcgctgtgcgggccacgcgcctggaaggagaccaacatggcgcgcacccagatcctctgcagccacctggagggccacagggtcacgtggaccggccgcttcaagtacgtccgcgtgactgacatcgacaacagcgccgagtctgccatcaacatgctcccgttcttcatcggcgactggatgcgctgcctctacggcgaggcctaccctgcctgcagccctggcaacacctccacggccgaggaggagctctgtcgccttaagctgctggccaagcacccctgccacatcaagaagttcgaccgctacaagtttgagattaccgtgggcatgccattcagcagcggcgctgacggctcgcgcagccgcgaggaggacgacgtcaccaaggacatcgtgctgcgggccagcagcgagttcaagagcgtgctgctcagcctgcgccagggcagcctcatcgagttcagcaccatcctggagggccgcctgggcagcaagtggcctgtcttcgagctcaaggccatcagctgcctcaactgcatggcccagctctcacccaccaggcggcacgtgaagatcgagcacgactggcgcagcaccgtgcatggcgccgtgaagttcgccttcgacttctttttcttcccattcctgtcggcggcctga
Sequence Length
2673
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
100,292 Da
NCBI Official Full Name
Homo sapiens Wolfram syndrome 1 (wolframin), mRNA
NCBI Official Synonym Full Names
wolframin ER transmembrane glycoprotein
NCBI Official Symbol
WFS1
NCBI Official Synonym Symbols
WFS; WFRS; WFSL; CTRCT41
NCBI Protein Information
wolframin
UniProt Protein Name
Wolframin
Protein Family
UniProt Gene Name
WFS1
UniProt Entry Name
WFS1_HUMAN

NCBI Description

This gene encodes a transmembrane protein, which is located primarily in the endoplasmic reticulum and ubiquitously expressed with highest levels in brain, pancreas, heart, and insulinoma beta-cell lines. Mutations in this gene are associated with Wolfram syndrome, also called DIDMOAD (Diabetes Insipidus, Diabetes Mellitus, Optic Atrophy, and Deafness), an autosomal recessive disorder. The disease affects the brain and central nervous system. Mutations in this gene can also cause autosomal dominant deafness 6 (DFNA6), also known as DFNA14 or DFNA38. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]

Uniprot Description

WFS1: Participates in the regulation of cellular Ca(2+) homeostasis, at least partly, by modulating the filling state of the endoplasmic reticulum Ca(2+) store. Highly expressed in heart followed by brain, placenta, lung and pancreas. Weakly expressed in liver, kidney and skeletal muscle. Also expressed in islet and beta-cell insulinoma cell line.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 4p16.1

Cellular Component: dendrite; endoplasmic reticulum; endoplasmic reticulum membrane; integral to endoplasmic reticulum membrane

Molecular Function: ATPase binding; protein binding; ubiquitin protein ligase binding

Biological Process: calcium ion homeostasis; endoplasmic reticulum calcium ion homeostasis; ER overload response; ER-associated protein catabolic process; glucose homeostasis; kidney development; negative regulation of neuron apoptosis; negative regulation of programmed cell death; negative regulation of transcription factor activity; negative regulation of transcription from RNA polymerase II promoter; neurological system process; positive regulation of calcium ion transport; positive regulation of growth; positive regulation of protein metabolic process; positive regulation of protein ubiquitination; protein maturation via protein folding; protein stabilization; renal water homeostasis; sensory perception of sound; visual perception

Disease: Cataract 41; Deafness, Autosomal Dominant 6; Diabetes Mellitus, Noninsulin-dependent; Wolfram Syndrome 1; Wolfram-like Syndrome, Autosomal Dominant

Research Articles on WFS1

Similar Products

Product Notes

The WFS1 wfs1 (Catalog #AAA1277636) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactcca acactgctcc gctgggcccc tcctgcccac agcccccgcc agcaccgcag ccccaggcgc gttcccgact caatgccaca gcctcgttgg agcaggagag gagcgaaagg ccccgagcac ccggacccca ggctggccct ggccctggtg ttagagacgc agcggccccc gctgaacccc aggcccagca taccaggagc cgggaaagag cagacggcac cgggcctaca aagggagaca tggaaatccc ctttgaagaa gtcctggaga gggccaaggc cggggacccc aaggcacaga ctgaggtggg gaagcactac ctgcagttgg ccggcgacac ggatgaagaa ctcaacagct gcaccgctgt ggactggctg gtcctcgccg cgaagcaggg ccgtcgcgag gctgtgaagc tgcttcgccg gtgcttggcg gacagaagag gcatcacgtc cgagaacgaa cgggaggtga ggcagctctc ctccgagacc gacctggaga gggccgtgcg caaggcagcc ctggtcatgt actggaagct caaccccaag aagaagaagc aggtggccgt ggcggagctg ctggagaatg tcggccaggt caacgagcac gatggagggg cgcagccagg ccccgtgccc aagtccctgc agaagcagag gcgcatgctg gagcgcctgg tcagcagcga gtccaagaac tacatcgcgc tggatgactt tgtggagatc actaagaagt acgccaaggg cgtcatcccc agcagcctgt tcctgcagga cgacgaagat gatgacgagc tggcggggaa gagccctgag gacctgccac tgcgtctgaa ggtggtcaag taccccctgc acgccatcat ggagatcaag gagtacctga ttgacatggc ctccagggca ggcatgcact ggctgtccac catcatcccc acgcaccaca tcaacgcgct catcttcttc ttcatcgtca gcaacctcac catcgacttc ttcgccttct tcatcccgct ggtcatcttc tacctgtcct tcatctccat ggtgatctgc accctcaagg tgttccagga cagcaaggcc tgggagaact tccgcaccct caccgacctg ctgctgcgct tcgagcccaa cctggatgtg gagcaggccg aggtcaactt cggctggaac cacctggagc cctatgccca tttcctgctc tctgtcttct tcgtcatctt ctccttcccc atcgccagca aggactgcat cccctgctcg gagctggctg tcatcaccgg cttctttacc gtgaccagct acctgagcct gagcacccat gcagagccct acacgcgcag ggccctggcc accgaggtca ccgccggcct gctatcgctg ctgccctcca tgcccttgaa ttggccctac ctgaaggtcc ttggccagac cttcatcacc gtgcctgtcg gccacctggt cgtcctcaac gtcagcgtcc cgtgcctgct ctatgtctac ctgctctatc tcttcttccg catggcacag ctgaggaatt tcaagggcac ctactgctac cttgtgccct acctggtgtg cttcatgtgg tgtgagctct ccgtggtcat cctgctggag tccaccggcc tggggctgct ccgcgcctcc atcggctact tcctcttcct ctttgccctc cccatcctgg tggccggcct ggccctggtg ggcgtgctgc agttcgcccg gtggttcacg tctctggagc tcaccaagat cgcagtcacc gtggcggtct gtagtgtgcc cctgctgttg cgctggtgga ccaaggccag cttctctgtg gtggggatgg tgaagtccct gacgcggagc tccatggtca agctcatcct ggtgtggctc acggccatcg tgctgttctg ctggttctat gtgtaccgct cagagggcat gaaggtctac aactccacac tgacctggca gcagtatggt gcgctgtgcg ggccacgcgc ctggaaggag accaacatgg cgcgcaccca gatcctctgc agccacctgg agggccacag ggtcacgtgg accggccgct tcaagtacgt ccgcgtgact gacatcgaca acagcgccga gtctgccatc aacatgctcc cgttcttcat cggcgactgg atgcgctgcc tctacggcga ggcctaccct gcctgcagcc ctggcaacac ctccacggcc gaggaggagc tctgtcgcct taagctgctg gccaagcacc cctgccacat caagaagttc gaccgctaca agtttgagat taccgtgggc atgccattca gcagcggcgc tgacggctcg cgcagccgcg aggaggacga cgtcaccaag gacatcgtgc tgcgggccag cagcgagttc aagagcgtgc tgctcagcct gcgccagggc agcctcatcg agttcagcac catcctggag ggccgcctgg gcagcaagtg gcctgtcttc gagctcaagg ccatcagctg cctcaactgc atggcccagc tctcacccac caggcggcac gtgaagatcg agcacgactg gcgcagcacc gtgcatggcg ccgtgaagtt cgccttcgac ttctttttct tcccattcct gtcggcggcc tga. It is sometimes possible for the material contained within the vial of "WFS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.