Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDR37 cdna clone

WDR37 cDNA Clone

Synonyms
WDR37; WDR37 cDNA Clone; WDR37 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccacagaaagcgcaagttgttcgactactcgccaaacaaaacagaagcgcaaatcccatagcctttctatacgaagaactaacagctcggagcaggagaggacgggactgccaagagacatgttagaaggacaagattctaaactgccttcctcggttcgcagtacacttctggaactgtttggtcaaatagaaagagaatttgaaaacctttatatcgaaaacttagaattacgtagagaaatcgacactcttaatgaacgtttagctgctgaaggacaagcgattgatggagcagagctgagtaagggccaactcaaaacaaaagccagtcacagcaccagccagctctcccagaaactgaagaccacttacaaggcttccaccagcaagattgtctccagctttaagaccacgacatcgagagctgcctgccagctcgtgaaggagtacatcggccaccgggacggcatctgggatgtcagcgtggccaagacacagccagtggtgctcgggactgcatcagccgatcacacggctttgctgtggagcatagagacagggaagtgcctagtcaagtacgcaggccacgtgggctcagtaaattctatcaaatttcatccctcagagcagttggctctcactgcttctggagataagactgctcatatctggagatacgcggtgcagctgccgacaccccagcctgttgctgacactagtgtaagcacctttccttacctgcgaatgtgtaggatgctgatgtctgcgaatctgagaatccatttatga
Sequence Length
795
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,265 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 37, mRNA
NCBI Official Synonym Full Names
WD repeat domain 37
NCBI Official Symbol
WDR37
NCBI Protein Information
WD repeat-containing protein 37
UniProt Protein Name
WD repeat-containing protein 37
UniProt Gene Name
WDR37
UniProt Synonym Gene Names
KIAA0982
UniProt Entry Name
WDR37_HUMAN

NCBI Description

This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]

Uniprot Description

WDR37: 3 isoforms of the human protein are produced by alternative splicing

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 10p15.3

Biological Process: maturation of 5.8S rRNA; maturation of LSU-rRNA

Research Articles on WDR37

Similar Products

Product Notes

The WDR37 wdr37 (Catalog #AAA1271703) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccacag aaagcgcaag ttgttcgact actcgccaaa caaaacagaa gcgcaaatcc catagccttt ctatacgaag aactaacagc tcggagcagg agaggacggg actgccaaga gacatgttag aaggacaaga ttctaaactg ccttcctcgg ttcgcagtac acttctggaa ctgtttggtc aaatagaaag agaatttgaa aacctttata tcgaaaactt agaattacgt agagaaatcg acactcttaa tgaacgttta gctgctgaag gacaagcgat tgatggagca gagctgagta agggccaact caaaacaaaa gccagtcaca gcaccagcca gctctcccag aaactgaaga ccacttacaa ggcttccacc agcaagattg tctccagctt taagaccacg acatcgagag ctgcctgcca gctcgtgaag gagtacatcg gccaccggga cggcatctgg gatgtcagcg tggccaagac acagccagtg gtgctcggga ctgcatcagc cgatcacacg gctttgctgt ggagcataga gacagggaag tgcctagtca agtacgcagg ccacgtgggc tcagtaaatt ctatcaaatt tcatccctca gagcagttgg ctctcactgc ttctggagat aagactgctc atatctggag atacgcggtg cagctgccga caccccagcc tgttgctgac actagtgtaa gcacctttcc ttacctgcga atgtgtagga tgctgatgtc tgcgaatctg agaatccatt tatga. It is sometimes possible for the material contained within the vial of "WDR37, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.