WDR18 cdna clone
WDR18 cDNA Clone
Gene Names
WDR18; Ipi3; R32184_1
Synonyms
WDR18; WDR18 cDNA Clone; WDR18 cdna clone
Sequence
atggcggcgcccatggaggtggccgtgtgtacggactcggcggccccgatgtggagctgcatcgtgtgggaacttcactcgggcgccaacctgctcacctaccgcggcggccaggcgggaccccgcggcctggcgctgctcaatggcgagtatctgctggcggcgcagctgggcaagaactacatcagcgcctgggagctgcagcggaaggaccagctccagcagaagatcatgtgccccgggcctgtcacctgtctgactgcatcacccaatggtctctacgtcctggcaggagttgcagaaagcatccacctgtgggaggtctccaccgggaaccttctggtcatcctgagtcgacactaccaggacgtctcctgccttcagttcacaggggacagcagccacttcatctcagggggcaaggactgcctggtgctggtttggagcctctgcagcgtgctgcaggccgacccctccaggattccggcgcccaggcacgtctggtctcaccacacgctccccatcacggacctgcactgcggctttgggggccccctggcccgggtggccacctcctcactggaccagacggtgaagctatgggaggtctcctcgggggagctgctgctctccgtcctctttgacgtgtccatcatggcagtgaccatggacctggctgagcaccatatgttctgcgggggcagtgagggctccatcttccaggtcgacctcttcacctggcccggacagagggagaggagcttccacccagagcaggacgccgggaaggtcttcaaagggcacaggaaccaggtgacttgcctgtcagtgtccactgacggcagcgtgctgctctcaggctcccacgacgagaccgtgcgcctctgggacgtgcagagcaagcagtgcatccggacggtggccctcaaaggcccagtcaccaatgccgccatcctgctggcgcccgtcagcatgctgagctcagacttcaggcccagcctgccgctgccccacttcaacaagcacctgctgggcgccgagcacggggacgagccgcgccacgggggcctcactctgcgcctgggcctccaccagcagggctcggagcccagctacctggaccgcacggagcagctgcaggccgtcctgtgcagcaccatggagaagagcgtgctcggcggccaggaccagctgcgcgtccgtgtgacggagctggaggacgaggtgcgcaacctgcgcaagatcaatcgggacctgttcgacttctccacgcgcttcatcacgcggccggccaagtga
Sequence Length
1299
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
47,405 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 18, mRNA
NCBI Official Synonym Full Names
WD repeat domain 18
NCBI Official Symbol
WDR18
NCBI Official Synonym Symbols
Ipi3; R32184_1
NCBI Protein Information
WD repeat-containing protein 18
UniProt Protein Name
WD repeat-containing protein 18
Protein Family
UniProt Gene Name
WDR18
UniProt Entry Name
WDR18_HUMAN
NCBI Description
This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Uniprot Description
WDR18: a WD40 repeat protein. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 19p13.3
Cellular Component: nucleoplasm
Molecular Function: protein binding
Biological Process: rRNA processing
Research Articles on WDR18
Similar Products
Product Notes
The WDR18 wdr18 (Catalog #AAA1271880) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgc ccatggaggt ggccgtgtgt acggactcgg cggccccgat gtggagctgc atcgtgtggg aacttcactc gggcgccaac ctgctcacct accgcggcgg ccaggcggga ccccgcggcc tggcgctgct caatggcgag tatctgctgg cggcgcagct gggcaagaac tacatcagcg cctgggagct gcagcggaag gaccagctcc agcagaagat catgtgcccc gggcctgtca cctgtctgac tgcatcaccc aatggtctct acgtcctggc aggagttgca gaaagcatcc acctgtggga ggtctccacc gggaaccttc tggtcatcct gagtcgacac taccaggacg tctcctgcct tcagttcaca ggggacagca gccacttcat ctcagggggc aaggactgcc tggtgctggt ttggagcctc tgcagcgtgc tgcaggccga cccctccagg attccggcgc ccaggcacgt ctggtctcac cacacgctcc ccatcacgga cctgcactgc ggctttgggg gccccctggc ccgggtggcc acctcctcac tggaccagac ggtgaagcta tgggaggtct cctcggggga gctgctgctc tccgtcctct ttgacgtgtc catcatggca gtgaccatgg acctggctga gcaccatatg ttctgcgggg gcagtgaggg ctccatcttc caggtcgacc tcttcacctg gcccggacag agggagagga gcttccaccc agagcaggac gccgggaagg tcttcaaagg gcacaggaac caggtgactt gcctgtcagt gtccactgac ggcagcgtgc tgctctcagg ctcccacgac gagaccgtgc gcctctggga cgtgcagagc aagcagtgca tccggacggt ggccctcaaa ggcccagtca ccaatgccgc catcctgctg gcgcccgtca gcatgctgag ctcagacttc aggcccagcc tgccgctgcc ccacttcaac aagcacctgc tgggcgccga gcacggggac gagccgcgcc acgggggcct cactctgcgc ctgggcctcc accagcaggg ctcggagccc agctacctgg accgcacgga gcagctgcag gccgtcctgt gcagcaccat ggagaagagc gtgctcggcg gccaggacca gctgcgcgtc cgtgtgacgg agctggagga cgaggtgcgc aacctgcgca agatcaatcg ggacctgttc gacttctcca cgcgcttcat cacgcggccg gccaagtga. It is sometimes possible for the material contained within the vial of "WDR18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
