WDR13 cdna clone
WDR13 cDNA Clone
Gene Names
WDR13; MG21
Synonyms
WDR13; WDR13 cDNA Clone; WDR13 cdna clone
Sequence
atggccgcggtgtggcagcaagtcttagcagtggacgcgaggtacaacgcgtaccgcacaccaacgtttccacagtttcggacgcagtatatccgccggcgcagccagctgctgcgggagaatgccaaggctgggcaccccccagcgctgcgtcggcagtacctgaggcttcgggggcagctgctgggccagcgctacgggcccctctccgagccaggcagtgctcgtgcctatagcaacagcatcgtccgcagtagccgcactactcttgaccgcatggaggactttgaggatgatcctcgggccctgggggcccgtgggcaccgtcgttctgtcagcagaggctcctaccagctgcaggcgcagatgaaccgtgccgtctatgaggacaggccccctggcagcgtggtgcccacgtcagcagcagaggcaagtcgggccatggccggggacacgtcactgagcgagaactatgcctttgcgggcatgtatcatgtttttgaccagcacgtggatgaggcagtcccaagggtgcgcttcgccaatgatgaccgacaccgcctggcctgctgctcactcgacggcagcatctccctgtgccagctggtgcctgccccacccacagtgcttcgcgtgctacggggccacacccgtggtgtctccgacttcgcctggtccctctccaatgacatcctcgtgtccacctcactggatgccaccatgcgcatctgggcctctgaggatggtcgctgcatccgagagatccctgaccccgatagcgctgaactgctctgctgcaccttccagcctgtcaacaacaacctcactgtggtggggaacgccaagcacaacgtgcatgtcatgaacatctccacaggcaagaaagtgaaggggggctccagcaagctgacaggccgtgtccttgctctgtcctttgatgcccctggccggctgctctgggcgggtgatgaccgtggcagtgtcttctctttcctctttgatatggccacagggaagctgaccaaagccaagcgtttggtggtgcatgaggggagccctgtgaccagcatctcagcccggtcctgggtcagccgcgaggcccgggatccctcactgctcatcaatgcttgcctcaacaagttgctgctctacagggtggtagacaacgaggggaccctgcagctgaagagaagcttccccatcgagcagagctcacatcctgtgcgcagcatcttctgtcccctcatgtccttccgccagggggcctgcgtggtgacgggcagtgaggacatgtgcgtgcacttctttgatgtggagcgggcggccaaggctgctgtcaacaagctgcagggccacagtgcacctgtgcttgatgtcagcttcaactgcgacgagagcctactggcctccagtgacgccagcggcatggtcatcgtctggaggcgggagcagaagtag
Sequence Length
1458
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
43,037 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 13, mRNA
NCBI Official Synonym Full Names
WD repeat domain 13
NCBI Official Symbol
WDR13
NCBI Official Synonym Symbols
MG21
NCBI Protein Information
WD repeat-containing protein 13
UniProt Protein Name
WD repeat-containing protein 13
Protein Family
UniProt Gene Name
WDR13
UniProt Entry Name
WDR13_HUMAN
NCBI Description
This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by Gly-His and Trp-Asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is widely expressed in various tissues. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2009]
Uniprot Description
WDR13: a nuclear WD40 repeat protein. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: Xp11.23
Cellular Component: cytoplasm; nucleoplasm
Similar Products
Product Notes
The WDR13 wdr13 (Catalog #AAA1275052) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcgg tgtggcagca agtcttagca gtggacgcga ggtacaacgc gtaccgcaca ccaacgtttc cacagtttcg gacgcagtat atccgccggc gcagccagct gctgcgggag aatgccaagg ctgggcaccc cccagcgctg cgtcggcagt acctgaggct tcgggggcag ctgctgggcc agcgctacgg gcccctctcc gagccaggca gtgctcgtgc ctatagcaac agcatcgtcc gcagtagccg cactactctt gaccgcatgg aggactttga ggatgatcct cgggccctgg gggcccgtgg gcaccgtcgt tctgtcagca gaggctccta ccagctgcag gcgcagatga accgtgccgt ctatgaggac aggccccctg gcagcgtggt gcccacgtca gcagcagagg caagtcgggc catggccggg gacacgtcac tgagcgagaa ctatgccttt gcgggcatgt atcatgtttt tgaccagcac gtggatgagg cagtcccaag ggtgcgcttc gccaatgatg accgacaccg cctggcctgc tgctcactcg acggcagcat ctccctgtgc cagctggtgc ctgccccacc cacagtgctt cgcgtgctac ggggccacac ccgtggtgtc tccgacttcg cctggtccct ctccaatgac atcctcgtgt ccacctcact ggatgccacc atgcgcatct gggcctctga ggatggtcgc tgcatccgag agatccctga ccccgatagc gctgaactgc tctgctgcac cttccagcct gtcaacaaca acctcactgt ggtggggaac gccaagcaca acgtgcatgt catgaacatc tccacaggca agaaagtgaa ggggggctcc agcaagctga caggccgtgt ccttgctctg tcctttgatg cccctggccg gctgctctgg gcgggtgatg accgtggcag tgtcttctct ttcctctttg atatggccac agggaagctg accaaagcca agcgtttggt ggtgcatgag gggagccctg tgaccagcat ctcagcccgg tcctgggtca gccgcgaggc ccgggatccc tcactgctca tcaatgcttg cctcaacaag ttgctgctct acagggtggt agacaacgag gggaccctgc agctgaagag aagcttcccc atcgagcaga gctcacatcc tgtgcgcagc atcttctgtc ccctcatgtc cttccgccag ggggcctgcg tggtgacggg cagtgaggac atgtgcgtgc acttctttga tgtggagcgg gcggccaagg ctgctgtcaa caagctgcag ggccacagtg cacctgtgct tgatgtcagc ttcaactgcg acgagagcct actggcctcc agtgacgcca gcggcatggt catcgtctgg aggcgggagc agaagtag. It is sometimes possible for the material contained within the vial of "WDR13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
