WDR1 cdna clone
WDR1 cDNA Clone
Gene Names
WDR1; AIP1; NORI-1; HEL-S-52
Synonyms
WDR1; WDR1 cDNA Clone; WDR1 cdna clone
Sequence
atgccgtacgagatcaagaaggtgttcgccagcctcccgcaggtggagaggggcgtctccaagatcatcggcggcgaccctaagggcaacaattttctgtacaccaatggaaagtgcgtcatcctaaggaacatcgacaacccagcccttgctgacatctacacagagcacgcccatcaggtggtggtggccaagtatgcgcccagcggattctacattgcctccggagatgtgtctgggaagctgaggatctgggataccacgcagaaggagcacctgttgaagtatgagtaccagcctttcgctgggaagatcaaagacattgcttggactgaagacagtaagaggatcgccgtggtcggggaaggaagggagaagtttggagcagtcttcctctgggatagtggctcttctgtgggcgagattacaggacacaacaaagtcatcaacagcgtggacatcaagcagagccggccataccggctggccacgggaagcgatgataactgcgcggcattctttgagggacccccattcaagttcaagttcacagttggcgaccacagccgctttgtcaactgtgtgcgattctctcctgatgggaacagatttgccacagccagtgctgacggccagatatacatctatgacgggaagactggggagaaggtgtgcgcgctgggcggaagcaaggcccacgacggtgggatttacgcaattagttggagtcccgacagcacccatttgctttctgcttctggggacaaaacttccaagatttgggacgtcagcgtgaactccgtggtcagcacatttcccatgggctccacggttctggaccagcagctgggctgcctatggcagaaggaccacctgctcagtgtctccctgtccgggtacatcaactatctggacagaaacaaccccagcaagcccctgcacgtcatcaagggtcacagtaaatcgatccagtgtctgacggtgcataaaaacggcggcaagtcctacatttactctgggagccacgacggacacattaattactgggattcagagacgggggagaacgactccttcgctgggaaaggccacacgaaccaggtgtccaggatgaccgtggatgagtcggggcagctcatcagctgcagcatggacgacaccgtgcggtacaccagcctcatgctgcgggactacagcggacaaggagttgtgaaactggacgttcagccaaagtgcgtagccgtcggccccgggggatacgccgtggtcgtgtgcattggacagattgtcctgctgaaggatcagaggaagtgcttcagcatcgacaaccccggctacgagcccgaagttgtggcagtgcaccccggcggggacacggtggcaattgggggtgtggacggcaacgtccgcctgtattccatcctgggcaccacgctgaaggatgagggcaagctcctagaggccaagggccccgtgaccgacgtggcctactcccacgacggcgccttcctcgcggtgtgcgacgccagcaaggtggtcacagtgttcagcgttgctgacggctactcggagaacaatgttttttatggacaccatgcaaaaatcgtctgcctggcctggtccccagacaatgaacactttgcctccggtggcatggacatgatggtgtatgtttggaccctgagtgacccggaaaccagagtcaagatccaagatgcacaccggctgcaccatgtcagcagcctggcctggctggacgagcacacgctggtcacgacctcccatgatgcctctgtcaaggagtggacaatcacctactga
Sequence Length
1821
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
50,694 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 1, mRNA
NCBI Official Synonym Full Names
WD repeat domain 1
NCBI Official Symbol
WDR1
NCBI Official Synonym Symbols
AIP1; NORI-1; HEL-S-52
NCBI Protein Information
WD repeat-containing protein 1
UniProt Protein Name
WD repeat-containing protein 1
Protein Family
UniProt Gene Name
WDR1
UniProt Synonym Gene Names
AIP1
UniProt Entry Name
WDR1_HUMAN
NCBI Description
This gene encodes a protein containing 9 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, mostly including a trp-asp at the C-terminal end. WD domains are involved in protein-protein interactions. The encoded protein may help induce the disassembly of actin filaments. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Uniprot Description
WDR1: a WD40 repeat cytoskeletal protein that induces disassembly of actin filaments in conjunction with ADF/cofilin family proteins. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. Three alternatively spliced human isoforms have been described.
Protein type: Actin-binding
Chromosomal Location of Human Ortholog: 4p16.1
Cellular Component: cytoplasm; cytosol; extracellular region; intercellular junction
Molecular Function: actin filament binding
Biological Process: apical junction assembly; maintenance of epithelial cell polarity; platelet degranulation; regulation of actin filament depolymerization; sensory perception of sound
Research Articles on WDR1
Similar Products
Product Notes
The WDR1 wdr1 (Catalog #AAA1273887) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgtacg agatcaagaa ggtgttcgcc agcctcccgc aggtggagag gggcgtctcc aagatcatcg gcggcgaccc taagggcaac aattttctgt acaccaatgg aaagtgcgtc atcctaagga acatcgacaa cccagccctt gctgacatct acacagagca cgcccatcag gtggtggtgg ccaagtatgc gcccagcgga ttctacattg cctccggaga tgtgtctggg aagctgagga tctgggatac cacgcagaag gagcacctgt tgaagtatga gtaccagcct ttcgctggga agatcaaaga cattgcttgg actgaagaca gtaagaggat cgccgtggtc ggggaaggaa gggagaagtt tggagcagtc ttcctctggg atagtggctc ttctgtgggc gagattacag gacacaacaa agtcatcaac agcgtggaca tcaagcagag ccggccatac cggctggcca cgggaagcga tgataactgc gcggcattct ttgagggacc cccattcaag ttcaagttca cagttggcga ccacagccgc tttgtcaact gtgtgcgatt ctctcctgat gggaacagat ttgccacagc cagtgctgac ggccagatat acatctatga cgggaagact ggggagaagg tgtgcgcgct gggcggaagc aaggcccacg acggtgggat ttacgcaatt agttggagtc ccgacagcac ccatttgctt tctgcttctg gggacaaaac ttccaagatt tgggacgtca gcgtgaactc cgtggtcagc acatttccca tgggctccac ggttctggac cagcagctgg gctgcctatg gcagaaggac cacctgctca gtgtctccct gtccgggtac atcaactatc tggacagaaa caaccccagc aagcccctgc acgtcatcaa gggtcacagt aaatcgatcc agtgtctgac ggtgcataaa aacggcggca agtcctacat ttactctggg agccacgacg gacacattaa ttactgggat tcagagacgg gggagaacga ctccttcgct gggaaaggcc acacgaacca ggtgtccagg atgaccgtgg atgagtcggg gcagctcatc agctgcagca tggacgacac cgtgcggtac accagcctca tgctgcggga ctacagcgga caaggagttg tgaaactgga cgttcagcca aagtgcgtag ccgtcggccc cgggggatac gccgtggtcg tgtgcattgg acagattgtc ctgctgaagg atcagaggaa gtgcttcagc atcgacaacc ccggctacga gcccgaagtt gtggcagtgc accccggcgg ggacacggtg gcaattgggg gtgtggacgg caacgtccgc ctgtattcca tcctgggcac cacgctgaag gatgagggca agctcctaga ggccaagggc cccgtgaccg acgtggccta ctcccacgac ggcgccttcc tcgcggtgtg cgacgccagc aaggtggtca cagtgttcag cgttgctgac ggctactcgg agaacaatgt tttttatgga caccatgcaa aaatcgtctg cctggcctgg tccccagaca atgaacactt tgcctccggt ggcatggaca tgatggtgta tgtttggacc ctgagtgacc cggaaaccag agtcaagatc caagatgcac accggctgca ccatgtcagc agcctggcct ggctggacga gcacacgctg gtcacgacct cccatgatgc ctctgtcaag gagtggacaa tcacctactg a. It is sometimes possible for the material contained within the vial of "WDR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
