WDFY4 cdna clone
WDFY4 cDNA Clone
Gene Names
WDFY4; C10orf64
Synonyms
WDFY4; WDFY4 cDNA Clone; WDFY4 cdna clone
Sequence
atggaggcagaagatctttcaaaggctgaagacagaaatgaagacccaggttccaaaaatgaagggcagcttgctgctgtgcagcctgatgtcccacatggagggcagtcctccagccccacagctctctgggacatgctggaaaggaagtttctggaataccagcagttgactcacaagagccccattgagcgtcagaagagcctgttgagtcttctccccctattcctaaaggcctgggaacactccgtggggatcatctgctttcccagtctccaaaggctggctgaagacgtgtctgaccagcttgcccagcaactccagaaggcccttgtggggaagcctgcggagcaagctcggttggcagctggacagttgctgtggtggaagggggacgtggatcaggatggctacttgctcctgaagtcagtgtacgtgctcacggggacagactcggagacgctgggcagggttgctgagtctgggcttccagccctgctcctacagtgcctttacctcttctttgtctttcctctggacaaagatgagcttcttgagagtgatcttcaagttcaaaagatgttcgtgcagatgttgctcaatatttgcagtgactctcagggcctggagggactcctctcaggaagtgagctgcagtctctgctgattgccacgacctgccttcgggagcacagctgctgcttctggaaggaacccaccttctgcgtgctaagggcaatctccaaggcccagaacctcagcatcatccagtacctgcaggccacagactgtgtcaggctctccctccagaacctctccaggctcacggacactctccctgcccctgaagtgagcgaggctgtaagcctgatcttgggattcgtgaaggactcctaccccgtctcctcggctctgttcctggagtttgagaattcagagggctatcctctgctgctcaaagtgttacttcggtatgatgggctgacccagagcgaagtggacccgcatctggaggagctccttgggctggtggtgtggctgacaacctgtgggaggtcagagctgaaggtgtttgacagcatcacttaccctcagcttgaaggcttcaagttccatcatgaggcatctggggtgactgttaagaatcttcaggccttccaggtcctacagaatgttttccacaaagccagtgactctgtcctctgcatacaagtcttgtcagtcatcaggaccatgtgggcctggaatgctcgaaacttcttcctgctggagtggaccctgcagcccatctcgcagtttgtagagatcatgcccctgaagccggccccagtgcaggaacacttcttccagcttctagaggccctggtgttcgagctgcactacgtgcctcatgagatcctgcgaaaggtacagcatctgatcaaggagagccctgggccatcctgcaccctcatggccctgcagagcatcctcagcatcgctggtggggaccccctcttcaccgacatcttccgggactcagggctcctgggcctgctactggcacagcttcggaagcaagccaagatcatgaggaagtcaggaaacaaagtgtccactcctggtgttcaggatccagaaagagaactcacctgtgtgatgctgaggattgtagtcacacttctgaaaggctcggtgaggaatgcagttgtcctgaaggaccacggcatggtgcccttcatcaagatcttcctggatgacgagtgctaccgggaggcctcgctcagcatcttggagcagctctcagccatcaacgccgaggagtacatgagcatcattgtgggtgctctatgctcatccactcaaggggagctgcagctgaaactggatctcctgaaggtgatttcaagtcctcctttgagattggcttccctgtggatatgcaccaagcgatccacatttgctcaggcatttgtattcatgtaa
Sequence Length
1965
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
325,232 Da
NCBI Official Full Name
Homo sapiens WDFY family member 4, mRNA
NCBI Official Synonym Full Names
WDFY family member 4
NCBI Official Symbol
WDFY4
NCBI Official Synonym Symbols
C10orf64
NCBI Protein Information
WD repeat- and FYVE domain-containing protein 4
UniProt Protein Name
WD repeat- and FYVE domain-containing protein 4
Protein Family
UniProt Gene Name
WDFY4
UniProt Synonym Gene Names
C10orf64; KIAA1607
UniProt Entry Name
WDFY4_HUMAN
Uniprot Description
WDFY4: 5 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 10q11.23
Cellular Component: endomembrane system; extrinsic to membrane
Molecular Function: phospholipid binding
Research Articles on WDFY4
Similar Products
Product Notes
The WDFY4 wdfy4 (Catalog #AAA1271116) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcag aagatctttc aaaggctgaa gacagaaatg aagacccagg ttccaaaaat gaagggcagc ttgctgctgt gcagcctgat gtcccacatg gagggcagtc ctccagcccc acagctctct gggacatgct ggaaaggaag tttctggaat accagcagtt gactcacaag agccccattg agcgtcagaa gagcctgttg agtcttctcc ccctattcct aaaggcctgg gaacactccg tggggatcat ctgctttccc agtctccaaa ggctggctga agacgtgtct gaccagcttg cccagcaact ccagaaggcc cttgtgggga agcctgcgga gcaagctcgg ttggcagctg gacagttgct gtggtggaag ggggacgtgg atcaggatgg ctacttgctc ctgaagtcag tgtacgtgct cacggggaca gactcggaga cgctgggcag ggttgctgag tctgggcttc cagccctgct cctacagtgc ctttacctct tctttgtctt tcctctggac aaagatgagc ttcttgagag tgatcttcaa gttcaaaaga tgttcgtgca gatgttgctc aatatttgca gtgactctca gggcctggag ggactcctct caggaagtga gctgcagtct ctgctgattg ccacgacctg ccttcgggag cacagctgct gcttctggaa ggaacccacc ttctgcgtgc taagggcaat ctccaaggcc cagaacctca gcatcatcca gtacctgcag gccacagact gtgtcaggct ctccctccag aacctctcca ggctcacgga cactctccct gcccctgaag tgagcgaggc tgtaagcctg atcttgggat tcgtgaagga ctcctacccc gtctcctcgg ctctgttcct ggagtttgag aattcagagg gctatcctct gctgctcaaa gtgttacttc ggtatgatgg gctgacccag agcgaagtgg acccgcatct ggaggagctc cttgggctgg tggtgtggct gacaacctgt gggaggtcag agctgaaggt gtttgacagc atcacttacc ctcagcttga aggcttcaag ttccatcatg aggcatctgg ggtgactgtt aagaatcttc aggccttcca ggtcctacag aatgttttcc acaaagccag tgactctgtc ctctgcatac aagtcttgtc agtcatcagg accatgtggg cctggaatgc tcgaaacttc ttcctgctgg agtggaccct gcagcccatc tcgcagtttg tagagatcat gcccctgaag ccggccccag tgcaggaaca cttcttccag cttctagagg ccctggtgtt cgagctgcac tacgtgcctc atgagatcct gcgaaaggta cagcatctga tcaaggagag ccctgggcca tcctgcaccc tcatggccct gcagagcatc ctcagcatcg ctggtgggga ccccctcttc accgacatct tccgggactc agggctcctg ggcctgctac tggcacagct tcggaagcaa gccaagatca tgaggaagtc aggaaacaaa gtgtccactc ctggtgttca ggatccagaa agagaactca cctgtgtgat gctgaggatt gtagtcacac ttctgaaagg ctcggtgagg aatgcagttg tcctgaagga ccacggcatg gtgcccttca tcaagatctt cctggatgac gagtgctacc gggaggcctc gctcagcatc ttggagcagc tctcagccat caacgccgag gagtacatga gcatcattgt gggtgctcta tgctcatcca ctcaagggga gctgcagctg aaactggatc tcctgaaggt gatttcaagt cctcctttga gattggcttc cctgtggata tgcaccaagc gatccacatt tgctcaggca tttgtattca tgtaa. It is sometimes possible for the material contained within the vial of "WDFY4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
