Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WASH3P cdna clone

WASH3P cDNA Clone

Gene Names
WASH3P; FAM39DP
Synonyms
WASH3P; WASH3P cDNA Clone; WASH3P cdna clone
Ordering
For Research Use Only!
Sequence
atgactcctgtgaggatgcagcactccctggcaggtcagacctatgccgtgcccctcatccagccagacctgcggcgagaggaggccgtccagcagatggcggatgccctgcagtacctgcagaaggtctctggagacatcttcagcaggatctcccagcgggtagagcagagccggagccaggtgcaggccattggagagaaggtctccttggcccaggccaagattgagaagatcaagggcagcaagaaggccatcaaggtgttctccagtgccaagtaccctgctccagagcgcctgcaggaatatggctccatcttcacgggcgcccaggaccctggcctgcagagacgctcccgccacaggatccagagcaagcaccgccccctggacgagcgggccctgcaggagaagctgaagtactttcctgtgtgtgtgagcaccaagccggagcccgaggacgatgcagaagagggacttgggggtcttcccagcaacatcagctctgtcagctccttgctgctcttcaacaccaccgagaacctgtacaagaagtatgtcttcctggaccccctggctggtgctgtaacaaagacccatgtgatgctgggggcagagacagaggagaagctgtttgatgcccccttgtccatcagcaagagagagcagctggaacagcaggtcccagagaactacttctatgtgccagacctgggccaggtgcctgagattgatgttccgtcctacctgcctgacctgcccggcattgccaacgacctcatgtacagtgccgacctgggccccggcattgccccctctgcccctggcaccattccggaactgcccaccttccacactgaggtagccgagcctctcaaggcagacctacaagatggggtactaacagcaccaccaccacccccaccgcccccaccacctcccccagctcctgaggtgctggccagtgcatccccactcccaccctcaaccgcggcccctgtaggccaaggcgccaggcaggacgacagcagcagcagcgcgtctccttcagtccagggagctcccagggaagtggtcgacccctccggtggccgggccactctgctagagtccatccgccaagctgggggcatcggcaaggccaagctgcgcagcgtgaaggagcgaaagctggagaagaagaagcagaaggagcaggagcaagtgagagccacgagccaaggtggggacttgatgtcggatctcttcaacaagctggtcatgaggcgcaagggcatctctgggaaaggacctggggctggtgaggggcccggaggagcctttgcccgcgtgtcagactccatccctcctctgccgccaccgcagcagccacaggcagaggaggacgaggacgactgggaatcgtag
Sequence Length
1407
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,995 Da
NCBI Official Full Name
Homo sapiens WAS protein family homolog 2 pseudogene, mRNA
NCBI Official Synonym Full Names
WAS protein family homolog 3 pseudogene
NCBI Official Symbol
WASH3P
NCBI Official Synonym Symbols
FAM39DP
UniProt Protein Name
Putative WAS protein family homolog 3
UniProt Gene Name
WASH3P
UniProt Synonym Gene Names
FAM39DP
UniProt Entry Name
WASH3_HUMAN

Uniprot Description

Acts as a nucleation-promoting factor at the surface of endosomes, where it recruits and activates the Arp2/3 complex to induce actin polymerization, playing a key role in the fission of tubules that serve as transport intermediates during endosome sorting (PubMed:18159949, PubMed:20175130). Involved in endocytic trafficking of EGF (PubMed:20175130). Its assembly in the WASH core complex seems to inhibit its NPF activity and via FAM21 is required for its membrane targeting. Involved in transferrin receptor recycling. Regulates the trafficking of endosomal alpha5beta1 integrin to the plasma membrane and involved in invasive cell migration (). In T-cells involved in endosome-to-membrane recycling of receptors including T-cell receptor (TCR), CD28 and ITGAL; proposed to be implicated in T cell proliferation and effector function. In dendritic cells involved in endosome-to-membrane recycling of major histocompatibility complex (MHC) class II probably involving retromer and subsequently allowing antigen sampling, loading and presentation during T-cell activation. Involved in Arp2/3 complex-dependent actin assembly driving Salmonella typhimurium invasion independent of ruffling (). Involved in the exocytosis of MMP14 leading to matrix remodeling during invasive migration and implicating late endosome-to-plasma membrane tubular connections and cooperation with the exocyst complex (). Involved in negative regulation of autophagy independently from its role in endosomal sorting by inhibiting BECN1 ubiquitination to inactivate PIK3C3/Vps34 activity ().

Similar Products

Product Notes

The WASH3P wash3p (Catalog #AAA1274991) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactcctg tgaggatgca gcactccctg gcaggtcaga cctatgccgt gcccctcatc cagccagacc tgcggcgaga ggaggccgtc cagcagatgg cggatgccct gcagtacctg cagaaggtct ctggagacat cttcagcagg atctcccagc gggtagagca gagccggagc caggtgcagg ccattggaga gaaggtctcc ttggcccagg ccaagattga gaagatcaag ggcagcaaga aggccatcaa ggtgttctcc agtgccaagt accctgctcc agagcgcctg caggaatatg gctccatctt cacgggcgcc caggaccctg gcctgcagag acgctcccgc cacaggatcc agagcaagca ccgccccctg gacgagcggg ccctgcagga gaagctgaag tactttcctg tgtgtgtgag caccaagccg gagcccgagg acgatgcaga agagggactt gggggtcttc ccagcaacat cagctctgtc agctccttgc tgctcttcaa caccaccgag aacctgtaca agaagtatgt cttcctggac cccctggctg gtgctgtaac aaagacccat gtgatgctgg gggcagagac agaggagaag ctgtttgatg cccccttgtc catcagcaag agagagcagc tggaacagca ggtcccagag aactacttct atgtgccaga cctgggccag gtgcctgaga ttgatgttcc gtcctacctg cctgacctgc ccggcattgc caacgacctc atgtacagtg ccgacctggg ccccggcatt gccccctctg cccctggcac cattccggaa ctgcccacct tccacactga ggtagccgag cctctcaagg cagacctaca agatggggta ctaacagcac caccaccacc cccaccgccc ccaccacctc ccccagctcc tgaggtgctg gccagtgcat ccccactccc accctcaacc gcggcccctg taggccaagg cgccaggcag gacgacagca gcagcagcgc gtctccttca gtccagggag ctcccaggga agtggtcgac ccctccggtg gccgggccac tctgctagag tccatccgcc aagctggggg catcggcaag gccaagctgc gcagcgtgaa ggagcgaaag ctggagaaga agaagcagaa ggagcaggag caagtgagag ccacgagcca aggtggggac ttgatgtcgg atctcttcaa caagctggtc atgaggcgca agggcatctc tgggaaagga cctggggctg gtgaggggcc cggaggagcc tttgcccgcg tgtcagactc catccctcct ctgccgccac cgcagcagcc acaggcagag gaggacgagg acgactggga atcgtag. It is sometimes possible for the material contained within the vial of "WASH3P, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.