Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WAC cdna clone

WAC cDNA Clone

Gene Names
WAC; Wwp4; DESSH; BM-016; PRO1741
Synonyms
WAC; WAC cDNA Clone; WAC cdna clone
Ordering
For Research Use Only!
Sequence
atggtaatgtatgcgaggaaacagcagagactcagtgatggctgtcacgaccggaggggggactcgcagccttaccaggcacttaagtattcatcgaagagtcaccccagtagcggtgatcacagacatgaaaagatgcgagacgccggagatccttcaccaccaaataaaatgttgcggagatctgatagtcctgaaaacaaatacagtgacagcacaggtcacagtaaggccaaaaatgtgcatactcacagagttagagagagggatggtgggaccagttactctccacaagaaaattcacacaaccacagtgctcttcatagttcaaattcacattcttctaatccaagcaataacccaagcaaaacttcagatgcaccttatgattctgcagatgactggtctgagcatattagctcttctgggaaaaagtactactacaattgtcgaacagaagtttcacaatgggaaaaaccaaaagagtggcttgaaagagaacagagacaaaaagaagcaaacaagatggcagtcaacagcttcccaaaagatagggattacagaagagaggtgatgcaagcaacagccactagtgggtttgccagtggaatggaagacaagcattccagtgatgccagtagtttgctcccacagaatattttgtctcaaacaagcagacacaatgacagagactacagactgccaagagcagagactcacagtagttctacgccagtacagcaccccatcaaaccagtggttcatccaactgctaccccaagcactgttccttctagtccatttacgctacagtctgatcaccagccaaagaaatcatttgatgctaatggagcatctactttatcaaaactgcctacacccacatcttctgtccctgcacagaaaacagaaagaaaagaatctacatcaggagacaaacccgtatcacattcttgcacaactccttccacgtcttctgcctctggactgaaccccacatctgcacctccaacatctgcttcagcggtccctgtttctcctgttccacagtcgccaatacctcccttacttcaggacccaaatcttcttagacaattgcttcctgctttgcaagccacgctgcagcttaataattctaatgtggacatatctaaaataaatgaagttcttacagcagctgtgacacaagcctcactgcagtctataattcataagtttcttactgctggaccatctgctttcaacataacgtctctgatttctcaagctgctcagctctctacacaagcccagccatctaatcagtctccgatgtctttaacatctgatgcgtcatccccaagatcatatgtttctccaagaataagcacacctcaaactaacacagtccctatcaaacctttgatcagtactcctcctgtttcatcacagccaaaggttagtactccagtagttaagcaaggaccagtgtcacagtcagccacacagcagcctgtaactgctgacaagcagcaaggtcatgaacctgtctctcctcgaagtcttcagcgctcaagtagccagagaagtccatcacctggtcccaatcatacttctaatagtagtaatgcatcaaatgcaacagttgtaccacagaattcttctgcccgatccacgtgttcattaacgcctgcactagcagcacacttcagtgaaaatctcataaaacacgttcaaggatggcctgcagatcatgcagagaagcaggcatcaagattacgcgaagaagcgcataacatgggaactattcacatgtccgaaatttgtactgaattaaaaaatttaagatctttagtccgagtatgtgaaattcaagcaactttgcgagagcaaaggatactatttttgagacaacaaattaaggaacttgaaaagctaaaatcagaattccttcatggtgtgaagatgtga
Sequence Length
1950
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,505 Da
NCBI Official Full Name
Homo sapiens WW domain containing adaptor with coiled-coil, mRNA
NCBI Official Synonym Full Names
WW domain containing adaptor with coiled-coil
NCBI Official Symbol
WAC
NCBI Official Synonym Symbols
Wwp4; DESSH; BM-016; PRO1741
NCBI Protein Information
WW domain-containing adapter protein with coiled-coil
UniProt Protein Name
WW domain-containing adapter protein with coiled-coil
Protein Family
UniProt Gene Name
WAC
UniProt Synonym Gene Names
KIAA1844
UniProt Entry Name
WAC_HUMAN

NCBI Description

The protein encoded by this gene contains a WW domain, which is a protein module found in a wide range of signaling proteins. This domain mediates protein-protein interactions and binds proteins containing short linear peptide motifs that are proline-rich or contain at least one proline. This gene product shares 94% sequence identity with the WAC protein in mouse, however, its exact function is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]

Uniprot Description

WAC: Acts as a linker between gene transcription and histone H2B monoubiquitination at 'Lys-120' (H2BK120ub1). Interacts with the RNA polymerase II transcriptional machinery via its WW domain and with RNF20-RNF40 via its coiled coil region, thereby linking and regulating H2BK120ub1 and gene transcription. Regulates the cell-cycle checkpoint activation in response to DNA damage. Positive regulator of amino acid starvation-induced autophagy. May negatively regulate the ubiquitin proteasome pathway. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 10p12.1|10p12.1-p11.2

Cellular Component: nucleoplasm; nucleus

Molecular Function: chromatin binding; protein binding

Biological Process: histone monoubiquitination; negative regulation of proteasomal ubiquitin-dependent protein catabolic process; positive regulation of macroautophagy; positive regulation of transcription, DNA-dependent; response to DNA damage stimulus

Disease: Desanto-shinawi Syndrome

Research Articles on WAC

Similar Products

Product Notes

The WAC wac (Catalog #AAA1270220) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtaatgt atgcgaggaa acagcagaga ctcagtgatg gctgtcacga ccggaggggg gactcgcagc cttaccaggc acttaagtat tcatcgaaga gtcaccccag tagcggtgat cacagacatg aaaagatgcg agacgccgga gatccttcac caccaaataa aatgttgcgg agatctgata gtcctgaaaa caaatacagt gacagcacag gtcacagtaa ggccaaaaat gtgcatactc acagagttag agagagggat ggtgggacca gttactctcc acaagaaaat tcacacaacc acagtgctct tcatagttca aattcacatt cttctaatcc aagcaataac ccaagcaaaa cttcagatgc accttatgat tctgcagatg actggtctga gcatattagc tcttctggga aaaagtacta ctacaattgt cgaacagaag tttcacaatg ggaaaaacca aaagagtggc ttgaaagaga acagagacaa aaagaagcaa acaagatggc agtcaacagc ttcccaaaag atagggatta cagaagagag gtgatgcaag caacagccac tagtgggttt gccagtggaa tggaagacaa gcattccagt gatgccagta gtttgctccc acagaatatt ttgtctcaaa caagcagaca caatgacaga gactacagac tgccaagagc agagactcac agtagttcta cgccagtaca gcaccccatc aaaccagtgg ttcatccaac tgctacccca agcactgttc cttctagtcc atttacgcta cagtctgatc accagccaaa gaaatcattt gatgctaatg gagcatctac tttatcaaaa ctgcctacac ccacatcttc tgtccctgca cagaaaacag aaagaaaaga atctacatca ggagacaaac ccgtatcaca ttcttgcaca actccttcca cgtcttctgc ctctggactg aaccccacat ctgcacctcc aacatctgct tcagcggtcc ctgtttctcc tgttccacag tcgccaatac ctcccttact tcaggaccca aatcttctta gacaattgct tcctgctttg caagccacgc tgcagcttaa taattctaat gtggacatat ctaaaataaa tgaagttctt acagcagctg tgacacaagc ctcactgcag tctataattc ataagtttct tactgctgga ccatctgctt tcaacataac gtctctgatt tctcaagctg ctcagctctc tacacaagcc cagccatcta atcagtctcc gatgtcttta acatctgatg cgtcatcccc aagatcatat gtttctccaa gaataagcac acctcaaact aacacagtcc ctatcaaacc tttgatcagt actcctcctg tttcatcaca gccaaaggtt agtactccag tagttaagca aggaccagtg tcacagtcag ccacacagca gcctgtaact gctgacaagc agcaaggtca tgaacctgtc tctcctcgaa gtcttcagcg ctcaagtagc cagagaagtc catcacctgg tcccaatcat acttctaata gtagtaatgc atcaaatgca acagttgtac cacagaattc ttctgcccga tccacgtgtt cattaacgcc tgcactagca gcacacttca gtgaaaatct cataaaacac gttcaaggat ggcctgcaga tcatgcagag aagcaggcat caagattacg cgaagaagcg cataacatgg gaactattca catgtccgaa atttgtactg aattaaaaaa tttaagatct ttagtccgag tatgtgaaat tcaagcaact ttgcgagagc aaaggatact atttttgaga caacaaatta aggaacttga aaagctaaaa tcagaattcc ttcatggtgt gaagatgtga. It is sometimes possible for the material contained within the vial of "WAC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.