Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VWA3B cdna clone

VWA3B cDNA Clone

Gene Names
VWA3B; SCAR22
Synonyms
VWA3B; VWA3B cDNA Clone; VWA3B cdna clone
Ordering
For Research Use Only!
Sequence
atggccacgaaaggcatgaggttgaaatccacaaaagaggtgttccctctggcacatgtgtgcaacgacacaaataagatgacattaattaacccccaaggagccaaactcaatatctacaagcgaaaagtggaacaggcaattcaatcctatgaaaagcgcttgaataaaattgtttggcgagcattatctcaagaggaaaaagaaaagttagatgcaaacaaaccaatacagtacttggaaaacaaaacagttttaaaccaggctttagaacggttgaattggcccatttcactgaaagagctgtcgatgctggaaagtgaaatcctagctgggaaaatgtacatccagcaggccatggaactccaggaggctgccaagaagaattatgcaaacaaggccccgggagagcaacagaaattgcaaggaaatccaacaaagaaaaccaaatcaaaaagaccagatcccctcaaaggacagaaggttattgcaagatgcgatgaaaatggcttttattttccaggggttgtgaagaagtgtgtgagccgcacccaagcactggtgggcttcagttacggagacaccaaggtcgtgtccacctccttcatcacgcctgtggggggcgccatgccctgcccgctgctccaggttggagattatgtgtttgccaaaattgtgatacccaaaggatttgacttctatgtccctgccattgtcatagcacttcccaataagcatgtggccacagaaaaattctacacagttttgaagtgtaacaaccggagagaattttgccctcggagtgcacttattaagatcagccaaaacaagtatgcgctctcttgctctcatataaagtcacccccaattcctgagggtccagaagtagaggatgtggaggcgaggaactctgctttcctcttctggccactgaaagaagcggacacgcaggattccagagagccaagacgagagaagcccaggaggaaaaagaggcccgccaagcagccactccagcaggcggcgccctcggactcggacggctcctcccacggcatcagctcccatgggtcctgccaggggacacaccccgagcccaagacagcccacctccacttccccgcggccgggcgtctaggactcagcagccacgccatcattgccacacctccacctcgagcagccctgccctgtactctccaagccacccacagcagcaaagggctgaggagcgtccctgagacactttaa
Sequence Length
1251
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
122,697 Da
NCBI Official Full Name
Homo sapiens von Willebrand factor A domain containing 3B, mRNA
NCBI Official Synonym Full Names
von Willebrand factor A domain containing 3B
NCBI Official Symbol
VWA3B
NCBI Official Synonym Symbols
SCAR22
NCBI Protein Information
von Willebrand factor A domain-containing protein 3B
UniProt Protein Name
von Willebrand factor A domain-containing protein 3B
UniProt Gene Name
VWA3B
UniProt Entry Name
VWA3B_HUMAN

Uniprot Description

VWA3B: 8 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 2q11.2

Disease: Spinocerebellar Ataxia, Autosomal Recessive 22

Research Articles on VWA3B

Similar Products

Product Notes

The VWA3B vwa3b (Catalog #AAA1276662) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccacga aaggcatgag gttgaaatcc acaaaagagg tgttccctct ggcacatgtg tgcaacgaca caaataagat gacattaatt aacccccaag gagccaaact caatatctac aagcgaaaag tggaacaggc aattcaatcc tatgaaaagc gcttgaataa aattgtttgg cgagcattat ctcaagagga aaaagaaaag ttagatgcaa acaaaccaat acagtacttg gaaaacaaaa cagttttaaa ccaggcttta gaacggttga attggcccat ttcactgaaa gagctgtcga tgctggaaag tgaaatccta gctgggaaaa tgtacatcca gcaggccatg gaactccagg aggctgccaa gaagaattat gcaaacaagg ccccgggaga gcaacagaaa ttgcaaggaa atccaacaaa gaaaaccaaa tcaaaaagac cagatcccct caaaggacag aaggttattg caagatgcga tgaaaatggc ttttattttc caggggttgt gaagaagtgt gtgagccgca cccaagcact ggtgggcttc agttacggag acaccaaggt cgtgtccacc tccttcatca cgcctgtggg gggcgccatg ccctgcccgc tgctccaggt tggagattat gtgtttgcca aaattgtgat acccaaagga tttgacttct atgtccctgc cattgtcata gcacttccca ataagcatgt ggccacagaa aaattctaca cagttttgaa gtgtaacaac cggagagaat tttgccctcg gagtgcactt attaagatca gccaaaacaa gtatgcgctc tcttgctctc atataaagtc acccccaatt cctgagggtc cagaagtaga ggatgtggag gcgaggaact ctgctttcct cttctggcca ctgaaagaag cggacacgca ggattccaga gagccaagac gagagaagcc caggaggaaa aagaggcccg ccaagcagcc actccagcag gcggcgccct cggactcgga cggctcctcc cacggcatca gctcccatgg gtcctgccag gggacacacc ccgagcccaa gacagcccac ctccacttcc ccgcggccgg gcgtctagga ctcagcagcc acgccatcat tgccacacct ccacctcgag cagccctgcc ctgtactctc caagccaccc acagcagcaa agggctgagg agcgtccctg agacacttta a. It is sometimes possible for the material contained within the vial of "VWA3B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.