Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VPS16 cdna clone

VPS16 cDNA Clone

Gene Names
VPS16; hVPS16
Synonyms
VPS16; VPS16 cDNA Clone; VPS16 cdna clone
Ordering
For Research Use Only!
Sequence
atgccctggctctggactgctccccaccagaaagagagccagaaggcggacgagtacctgcgggagatccaggagctgggccagctgacccaggccgtgcagcagtgcattgaggctgcaggacatgagcaccagccagacatgcagaagagtctgctcagggttggcctggatggccgggccggggagggtggggctgggagggggtgggatgggcagcagggaagctctctcctatcgccctctggctcttctcaggccgcctccttcggaaagtgtttcctggacagatttccacccgacagcttcgtgcacatgtgtcaggacctgcgtgtgctcaatgctgttcgggactatcacatcgggatcccgctcacctatagccaatataagcagctcaccatccaggtgctgctggacaggctcgtgttgcggagactttaccccctggccatccagatatgcgagtacttgcgccttcctgaagtacagggcgtcagcaggatcctggcccactgggcctgctacaaggtgcaacagaaggatgtctcagatgaggatgtggctcgagccattaaccagaagctgggggacacgcctggtgtctcttactccgacattgctgcacgagcctatggttgtggccgcacggagctggccatcaagctgctggagtatgagccacgctcaggggagcaggtaccccttctcctaaagatgaagaggagcaaactggcactaagcaaggccatcgagagcggggacactgacctggtgttcacggtgttgctgcacctgaagaacgagctgaaccgaggagattttttcatgacccttcggaatcagcccatggccctcagtttgtaccgacagttctgtaagcatcaggagctagagacgctgaaggacctttacaatcaggatgacaatcaccaggaattgggcagcttccacatccgagccagctatgctgcagaagagcgtattgaggggcgagtagcagctctgcagacagccgccgatgccttctacaaggccaagaatgagtttgcagccaaggctacagaggatcaaatgcggctcctacggctgcagcggcgcctagaagacgagctggggggccagttcctagacctgtctctacatgacacagttaccaccctcattcttggcggtcacaacaagcgtgcagagcagctggcacgtgacttccgcatccctgacaagaggctctggtggctgaagctgactgccctggcagatttggaagattgggaagagctagagaagttttccaagagcaagaaatcacccattggctacctgccttttgtggagatctgcatgaaacaacataacaaatacgaagccaagaagtatgcttcccgcgtgggtcccgagcagaaggtcaaggctttgcttcttgttggcgatgtggctcaggctgcagatgtggccatcgaacaccggaatgaggctgagctgagcctcgtattgtcccactgcacgggagccacagatggggccacagctgacaagattcaacgggccagggcacaagcccagaagaagtga
Sequence Length
1575
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
78,300 Da
NCBI Official Full Name
Homo sapiens vacuolar protein sorting 16 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
VPS16, CORVET/HOPS core subunit
NCBI Official Symbol
VPS16
NCBI Official Synonym Symbols
hVPS16
NCBI Protein Information
vacuolar protein sorting-associated protein 16 homolog
UniProt Protein Name
Vacuolar protein sorting-associated protein 16 homolog
UniProt Gene Name
VPS16
UniProt Synonym Gene Names
hVPS16
UniProt Entry Name
VPS16_HUMAN

NCBI Description

Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]

Uniprot Description

VPS16: May play a role in vesicle-mediated protein trafficking to lysosomal compartments and in membrane docking/fusion reactions of late endosomes/lysosomes. Belongs to the VPS16 family. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 20p13

Cellular Component: early endosome; late endosome; lysosomal membrane; lysosome; recycling endosome

Molecular Function: actin binding; protein binding

Biological Process: endosome to lysosome transport; regulation of vacuole fusion, non-autophagic

Research Articles on VPS16

Similar Products

Product Notes

The VPS16 vps16 (Catalog #AAA1277294) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccctggc tctggactgc tccccaccag aaagagagcc agaaggcgga cgagtacctg cgggagatcc aggagctggg ccagctgacc caggccgtgc agcagtgcat tgaggctgca ggacatgagc accagccaga catgcagaag agtctgctca gggttggcct ggatggccgg gccggggagg gtggggctgg gagggggtgg gatgggcagc agggaagctc tctcctatcg ccctctggct cttctcaggc cgcctccttc ggaaagtgtt tcctggacag atttccaccc gacagcttcg tgcacatgtg tcaggacctg cgtgtgctca atgctgttcg ggactatcac atcgggatcc cgctcaccta tagccaatat aagcagctca ccatccaggt gctgctggac aggctcgtgt tgcggagact ttaccccctg gccatccaga tatgcgagta cttgcgcctt cctgaagtac agggcgtcag caggatcctg gcccactggg cctgctacaa ggtgcaacag aaggatgtct cagatgagga tgtggctcga gccattaacc agaagctggg ggacacgcct ggtgtctctt actccgacat tgctgcacga gcctatggtt gtggccgcac ggagctggcc atcaagctgc tggagtatga gccacgctca ggggagcagg taccccttct cctaaagatg aagaggagca aactggcact aagcaaggcc atcgagagcg gggacactga cctggtgttc acggtgttgc tgcacctgaa gaacgagctg aaccgaggag attttttcat gacccttcgg aatcagccca tggccctcag tttgtaccga cagttctgta agcatcagga gctagagacg ctgaaggacc tttacaatca ggatgacaat caccaggaat tgggcagctt ccacatccga gccagctatg ctgcagaaga gcgtattgag gggcgagtag cagctctgca gacagccgcc gatgccttct acaaggccaa gaatgagttt gcagccaagg ctacagagga tcaaatgcgg ctcctacggc tgcagcggcg cctagaagac gagctggggg gccagttcct agacctgtct ctacatgaca cagttaccac cctcattctt ggcggtcaca acaagcgtgc agagcagctg gcacgtgact tccgcatccc tgacaagagg ctctggtggc tgaagctgac tgccctggca gatttggaag attgggaaga gctagagaag ttttccaaga gcaagaaatc acccattggc tacctgcctt ttgtggagat ctgcatgaaa caacataaca aatacgaagc caagaagtat gcttcccgcg tgggtcccga gcagaaggtc aaggctttgc ttcttgttgg cgatgtggct caggctgcag atgtggccat cgaacaccgg aatgaggctg agctgagcct cgtattgtcc cactgcacgg gagccacaga tggggccaca gctgacaaga ttcaacgggc cagggcacaa gcccagaaga agtga. It is sometimes possible for the material contained within the vial of "VPS16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.