VN1R2 cdna clone
VN1R2 cDNA Clone
Gene Names
VN1R2; V1RL2
Synonyms
VN1R2; VN1R2 cDNA Clone; VN1R2 cdna clone
Sequence
atgactcacactctttaccctaccccttttgctttgtatccaataaatatcagcgcagcctggcatttggggccactaccagtctcctgctttgtatccaataaatatcagcgcagcctggcattcggggccactaccggtctccgcgtcttggtggtagtggtcccccagacacagctgtcttttctttcatctctttgtcttgtgtctttatttctacactctcttgtctctgcacacggagagaaacccaccaaacctgtggggctggaccctacactattccaggtagttgttggaatcctggggaatttttcactcttatattattatatgttcctttactttaggggatacaagccaagatccacagatttgattctcaggcacctgactgtagctgactccttggttatcctatctaaaagaatcccagagaccatggcaacttttgggttgaaacattttgacaattattttggatgcaaatttcttttgtatgcacacagggtaggcaggggtgtgtccattggaagcacctgcctcttgagtgtcttccaggtgatcaccatcaaccctaggaactccaggtgggcagagatgaaagtaaaagccccgacatacattggtctctccaatatcctgtgctgggccttccacatgctggtaaatgccatttttcctatttatacaactggcaaatggagcaacaacaacatcacaaagaaaggagatttgggatattgttctgccccacttagtgatgaagtcacaaagtcagtatatgcagcattgacatccttccatgatgttttgtgtctggggctcatgctctgggccagcagctccatcgttttggtcttgtacaggcacaaacagcaggtacaacacatctgtaggaacaatctctaccccaactcttctcctgggaacagagccatccaaagcatccttgcattggtgagcacctttgcattatgttacgccctttccttcatcacctacgtttatttagctctcttcgataattccagttggtggctagtgaacactgctgcactaatcattgcctgttttccaactattagcccttttgttctcatgtgccgtgaccccagcagatccaggctctgcagtatctgctgcagaagaaatagacgattctttcatgatttcaggaaaatgtga
Sequence Length
1188
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,476 Da
NCBI Official Full Name
Homo sapiens vomeronasal 1 receptor 2, mRNA
NCBI Official Synonym Full Names
vomeronasal 1 receptor 2
NCBI Official Symbol
VN1R2
NCBI Official Synonym Symbols
V1RL2
NCBI Protein Information
vomeronasal type-1 receptor 2
UniProt Protein Name
Vomeronasal type-1 receptor 2
Protein Family
UniProt Gene Name
VN1R2
UniProt Synonym Gene Names
V1RL2; hGPCR25
UniProt Entry Name
VN1R2_HUMAN
Uniprot Description
VN1R2: Putative pheromone receptor. Belongs to the G-protein coupled receptor 1 family.
Protein type: Membrane protein, multi-pass; GPCR, family 1; Receptor, GPCR; Membrane protein, integral
Chromosomal Location of Human Ortholog: 19q13.42
Similar Products
Product Notes
The VN1R2 vn1r2 (Catalog #AAA1265892) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactcaca ctctttaccc tacccctttt gctttgtatc caataaatat cagcgcagcc tggcatttgg ggccactacc agtctcctgc tttgtatcca ataaatatca gcgcagcctg gcattcgggg ccactaccgg tctccgcgtc ttggtggtag tggtccccca gacacagctg tcttttcttt catctctttg tcttgtgtct ttatttctac actctcttgt ctctgcacac ggagagaaac ccaccaaacc tgtggggctg gaccctacac tattccaggt agttgttgga atcctgggga atttttcact cttatattat tatatgttcc tttactttag gggatacaag ccaagatcca cagatttgat tctcaggcac ctgactgtag ctgactcctt ggttatccta tctaaaagaa tcccagagac catggcaact tttgggttga aacattttga caattatttt ggatgcaaat ttcttttgta tgcacacagg gtaggcaggg gtgtgtccat tggaagcacc tgcctcttga gtgtcttcca ggtgatcacc atcaacccta ggaactccag gtgggcagag atgaaagtaa aagccccgac atacattggt ctctccaata tcctgtgctg ggccttccac atgctggtaa atgccatttt tcctatttat acaactggca aatggagcaa caacaacatc acaaagaaag gagatttggg atattgttct gccccactta gtgatgaagt cacaaagtca gtatatgcag cattgacatc cttccatgat gttttgtgtc tggggctcat gctctgggcc agcagctcca tcgttttggt cttgtacagg cacaaacagc aggtacaaca catctgtagg aacaatctct accccaactc ttctcctggg aacagagcca tccaaagcat ccttgcattg gtgagcacct ttgcattatg ttacgccctt tccttcatca cctacgttta tttagctctc ttcgataatt ccagttggtg gctagtgaac actgctgcac taatcattgc ctgttttcca actattagcc cttttgttct catgtgccgt gaccccagca gatccaggct ctgcagtatc tgctgcagaa gaaatagacg attctttcat gatttcagga aaatgtga. It is sometimes possible for the material contained within the vial of "VN1R2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
