Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VIP cdna clone

VIP cDNA Clone

Gene Names
VIP; PHM27
Synonyms
VIP; VIP cDNA Clone; VIP cdna clone
Ordering
For Research Use Only!
Sequence
atggacaccagaaataaggcccagctccttgtgctcctgactcttctcagtgtgctcttctcacagacttcggcatggcctctttacagggcaccttctgctctcaggttgggtgacagaataccctttgagggagcaaatgaacctgatcaagtttcattaaaagaagacattgacatgttgcaaaatgcattagctgaaaatgacacaccctattatgatgtatccagaaatgccaggcatgctgatggagttttcaccagtgacttcagtaaactcttgggtcaactttctgccaaaaagtaccttgagtctcttatgggaaaacgtgttagtaacatctcagaagaccctgtaccagtcaaacgtcactcagatgcagtcttcactgacaactatacccgccttagaaaacaaatggctgtaaagaaatatttgaactcaattctgaatggaaagaggagcagtgagggagaatctcccgactttccagaagagttagaaaaatga
Sequence Length
510
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,082 Da
NCBI Official Full Name
Homo sapiens vasoactive intestinal peptide, mRNA
NCBI Official Synonym Full Names
vasoactive intestinal peptide
NCBI Official Symbol
VIP
NCBI Official Synonym Symbols
PHM27
NCBI Protein Information
VIP peptides
UniProt Protein Name
VIP peptides
Protein Family
UniProt Gene Name
VIP
UniProt Synonym Gene Names
VIP
UniProt Entry Name
VIP_HUMAN

NCBI Description

The protein encoded by this gene belongs to the glucagon family. It stimulates myocardial contractility, causes vasodilation, increases glycogenolysis, lowers arterial blood pressure and relaxes the smooth muscle of trachea, stomach and gall bladder. The protein also acts as an antimicrobial peptide with antibacterial and antifungal activity. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2014]

Uniprot Description

VIP: VIP causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder. Belongs to the glucagon family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 6q25

Cellular Component: extracellular region

Molecular Function: hormone activity; neuropeptide hormone activity; protein binding

Biological Process: body fluid secretion; G-protein coupled receptor protein signaling pathway; mRNA stabilization; positive regulation of cell proliferation; positive regulation of protein catabolic process; regulation of protein localization

Research Articles on VIP

Similar Products

Product Notes

The VIP vip (Catalog #AAA1269199) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacacca gaaataaggc ccagctcctt gtgctcctga ctcttctcag tgtgctcttc tcacagactt cggcatggcc tctttacagg gcaccttctg ctctcaggtt gggtgacaga ataccctttg agggagcaaa tgaacctgat caagtttcat taaaagaaga cattgacatg ttgcaaaatg cattagctga aaatgacaca ccctattatg atgtatccag aaatgccagg catgctgatg gagttttcac cagtgacttc agtaaactct tgggtcaact ttctgccaaa aagtaccttg agtctcttat gggaaaacgt gttagtaaca tctcagaaga ccctgtacca gtcaaacgtc actcagatgc agtcttcact gacaactata cccgccttag aaaacaaatg gctgtaaaga aatatttgaa ctcaattctg aatggaaaga ggagcagtga gggagaatct cccgactttc cagaagagtt agaaaaatga. It is sometimes possible for the material contained within the vial of "VIP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.