VAT1L cdna clone
VAT1L cDNA Clone
Synonyms
VAT1L; VAT1L cDNA Clone; VAT1L cdna clone
Sequence
atggccaaggaaggcgtggagaaggcggaggagacggagcaaatgatcgagaaggaggcaggcaaggagccggcggagggcggcggcggcgacggctcgcaccgcctcggggacgcccaggagatgcgcgcggtggtgctggctggcttcggggggctcaacaagctgcggctcttcaggaaggccatgcccgagcctcaggacggcgagctcaagatccgcgtcaaagcctgtggattaaacttcattgacttgatggtgcgacaagggaatattgacaaccctcccaagactcccctggtgccaggatttgagtgttctgggattgttgaagctctgggggacagcgtgaaaggatatgagattggagaccgtgtcatggcatttgtcaattacaatgcctgggcagaggtggtctgcacaccagtggagtttgtctacaagatcccggatgacatgagcttctcggaggctgctgcattccccatgaacttcgtcacagcctatgtgatgctgtttgaagttgccaacctccgggaagggatgtctgtgctcgtgcactcagctggtgggggcgtgggtcaagctgtggctcagctgtgttccactgtccccaacgtgactgtctttggaacagcctctactttcaagcatgaagcaatcaaagactctgtgacccacctctttgacagaaatgcagactacgtgcaagaagttaaaagaatctctgctgaaggtgtggacatcgttttggattgcctctgtggggacaacactggaaaaggtctcagtcttctcaaacccctgggaacctacattttatatggctcatccaacatggtaactggagagaccaagagcttcttcagctttgcaaaatcatggtggcaggtggagaaggtgaaccccatcaagctgtatgaggagaacaaagtcatcgcggggttttcccttttaaatctgctcttcaaacaaggccgggcgggcctcattcggggagtggtggaaaaactcatagggctctacaaccagaagaagatcaagcctgtggtggactccttgtgggctctggaggaggtgaaggaggccatgcagcggattcacgaccgagggaacattggcaagttaattctggatgtagaaaagaccccaactccactgatggccaatgacagcacagagaccagtgaagcaggggaagaggaggaggaccacgagggagacagcgagaacaaggagcggatgccctttatccagtaa
Sequence Length
1260
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
45,899 Da
NCBI Official Full Name
Homo sapiens vesicle amine transport protein 1 homolog (T. californica)-like, mRNA
NCBI Official Synonym Full Names
vesicle amine transport 1 like
NCBI Official Symbol
VAT1L
NCBI Protein Information
synaptic vesicle membrane protein VAT-1 homolog-like
UniProt Protein Name
Synaptic vesicle membrane protein VAT-1 homolog-like
Protein Family
UniProt Gene Name
VAT1L
UniProt Synonym Gene Names
KIAA1576
UniProt Entry Name
VAT1L_HUMAN
Uniprot Description
VAT1L: Belongs to the zinc-containing alcohol dehydrogenase family. Quinone oxidoreductase subfamily.
Protein type: EC 1.-.-.-; Oxidoreductase
Chromosomal Location of Human Ortholog: 16q23.1
Molecular Function: protein binding
Research Articles on VAT1L
Similar Products
Product Notes
The VAT1L vat1l (Catalog #AAA1276867) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaagg aaggcgtgga gaaggcggag gagacggagc aaatgatcga gaaggaggca ggcaaggagc cggcggaggg cggcggcggc gacggctcgc accgcctcgg ggacgcccag gagatgcgcg cggtggtgct ggctggcttc ggggggctca acaagctgcg gctcttcagg aaggccatgc ccgagcctca ggacggcgag ctcaagatcc gcgtcaaagc ctgtggatta aacttcattg acttgatggt gcgacaaggg aatattgaca accctcccaa gactcccctg gtgccaggat ttgagtgttc tgggattgtt gaagctctgg gggacagcgt gaaaggatat gagattggag accgtgtcat ggcatttgtc aattacaatg cctgggcaga ggtggtctgc acaccagtgg agtttgtcta caagatcccg gatgacatga gcttctcgga ggctgctgca ttccccatga acttcgtcac agcctatgtg atgctgtttg aagttgccaa cctccgggaa gggatgtctg tgctcgtgca ctcagctggt gggggcgtgg gtcaagctgt ggctcagctg tgttccactg tccccaacgt gactgtcttt ggaacagcct ctactttcaa gcatgaagca atcaaagact ctgtgaccca cctctttgac agaaatgcag actacgtgca agaagttaaa agaatctctg ctgaaggtgt ggacatcgtt ttggattgcc tctgtgggga caacactgga aaaggtctca gtcttctcaa acccctggga acctacattt tatatggctc atccaacatg gtaactggag agaccaagag cttcttcagc tttgcaaaat catggtggca ggtggagaag gtgaacccca tcaagctgta tgaggagaac aaagtcatcg cggggttttc ccttttaaat ctgctcttca aacaaggccg ggcgggcctc attcggggag tggtggaaaa actcataggg ctctacaacc agaagaagat caagcctgtg gtggactcct tgtgggctct ggaggaggtg aaggaggcca tgcagcggat tcacgaccga gggaacattg gcaagttaat tctggatgta gaaaagaccc caactccact gatggccaat gacagcacag agaccagtga agcaggggaa gaggaggagg accacgaggg agacagcgag aacaaggagc ggatgccctt tatccagtaa. It is sometimes possible for the material contained within the vial of "VAT1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
