Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VASP cdna clone

VASP cDNA Clone

Synonyms
VASP; VASP cDNA Clone; VASP cdna clone
Ordering
For Research Use Only!
Sequence
atgagcgagacggtcatctgttccagccgggccactgtgatgctttatgatgatggcaacaagcgatggctccctgctggcacgggtccccaggccttcagccgcgtccagatctaccacaaccccacggccaattcctttcgcgtcgtgggccggaagatgcagcccgaccagcaggtggtcatcaactgtgccatcgtccggggtgtcaagtataaccaggccacccccaacttccatcagtggcgcgacgctcgccaggtctggggcctcaacttcggcagcaaggaggatgcggcccagtttgccgccggcatggccagtgccctagaggcgttggaaggaggtgggccccctccacccccagcacttcccacctggtcggtcccgaacggcccctccccggaggaggtggagcagcagaaaaggcagcagcccggcccgtcggagcacatagagcgccgggtctccaatgcaggaggcccacctgctccccccgctgggggtccacccccaccaccaggacctccccctcctccaggtccccccccacccccaggtttgcccccttcgggggtcccagctgcagcgcacggagcagggggaggaccaccccctgcaccccctctcccggcagcacagggccctggtggtgggggagctggggccccaggcctggccgcagctattgctggagccaaactcaggaaagtcagcaagcaggaggaggcctcaggggggcccacagcccccaaagctgagagtggtcgaagcggaggtgggggactcatggaagagatgaacgccatgctggcccggagaaggaaagccacgcaagttggggagaaaacccccaaggatgaatctgccaatcaggaggagccagaggccagagtcccggcccagagtgaatctgtgcggagaccctgggagaagaacagcacaaccttgccaaggatgaagtcgtcttcttcggtgaccacttccgagacccaaccctgcacgcccagctccagtgattactcggacctacagagggtgaaacaggagcttctggaagaggtgaagaaggaattgcagaaagtgaaagaggaaatcattgaagccttcgtccaggagctgaggaagcggggttctccctga
Sequence Length
1143
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,830 Da
NCBI Official Full Name
Homo sapiens vasodilator-stimulated phosphoprotein, mRNA
NCBI Official Synonym Full Names
vasodilator-stimulated phosphoprotein
NCBI Official Symbol
VASP
NCBI Protein Information
vasodilator-stimulated phosphoprotein
UniProt Protein Name
Vasodilator-stimulated phosphoprotein
UniProt Gene Name
VASP
UniProt Synonym Gene Names
VASP
UniProt Entry Name
VASP_HUMAN

NCBI Description

Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In the mid-region of the protein, family members have a proline-rich domain that binds SH3 and WW domain-containing proteins. Their C-terminal EVH2 domain mediates tetramerization and binds both G and F actin. VASP is associated with filamentous actin formation and likely plays a widespread role in cell adhesion and motility. VASP may also be involved in the intracellular signaling pathways that regulate integrin-extracellular matrix interactions. VASP is regulated by the cyclic nucleotide-dependent kinases PKA and PKG. [provided by RefSeq, Jul 2008]

Uniprot Description

VASP: vasodilator-stimulated phosphoprotein. Actin- and profilin-binding microfilament-associated protein. The phosphorylation of VASP is dynamically regulated by cellular adhesion to extracellular matrix.

Protein type: Motility/polarity/chemotaxis; Cytoskeletal

Chromosomal Location of Human Ortholog: 19q13.32

Cellular Component: actin cytoskeleton; cell-cell adherens junction; cytoplasm; cytosol; focal adhesion; plasma membrane

Molecular Function: profilin binding; protein binding

Biological Process: axon guidance; positive regulation of actin filament polymerization

Research Articles on VASP

Similar Products

Product Notes

The VASP vasp (Catalog #AAA1277384) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgaga cggtcatctg ttccagccgg gccactgtga tgctttatga tgatggcaac aagcgatggc tccctgctgg cacgggtccc caggccttca gccgcgtcca gatctaccac aaccccacgg ccaattcctt tcgcgtcgtg ggccggaaga tgcagcccga ccagcaggtg gtcatcaact gtgccatcgt ccggggtgtc aagtataacc aggccacccc caacttccat cagtggcgcg acgctcgcca ggtctggggc ctcaacttcg gcagcaagga ggatgcggcc cagtttgccg ccggcatggc cagtgcccta gaggcgttgg aaggaggtgg gccccctcca cccccagcac ttcccacctg gtcggtcccg aacggcccct ccccggagga ggtggagcag cagaaaaggc agcagcccgg cccgtcggag cacatagagc gccgggtctc caatgcagga ggcccacctg ctccccccgc tgggggtcca cccccaccac caggacctcc ccctcctcca ggtccccccc cacccccagg tttgccccct tcgggggtcc cagctgcagc gcacggagca gggggaggac caccccctgc accccctctc ccggcagcac agggccctgg tggtggggga gctggggccc caggcctggc cgcagctatt gctggagcca aactcaggaa agtcagcaag caggaggagg cctcaggggg gcccacagcc cccaaagctg agagtggtcg aagcggaggt gggggactca tggaagagat gaacgccatg ctggcccgga gaaggaaagc cacgcaagtt ggggagaaaa cccccaagga tgaatctgcc aatcaggagg agccagaggc cagagtcccg gcccagagtg aatctgtgcg gagaccctgg gagaagaaca gcacaacctt gccaaggatg aagtcgtctt cttcggtgac cacttccgag acccaaccct gcacgcccag ctccagtgat tactcggacc tacagagggt gaaacaggag cttctggaag aggtgaagaa ggaattgcag aaagtgaaag aggaaatcat tgaagccttc gtccaggagc tgaggaagcg gggttctccc tga. It is sometimes possible for the material contained within the vial of "VASP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.