Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UXT cdna clone

UXT cDNA Clone

Gene Names
UXT; STAP1; ART-27
Synonyms
UXT; UXT cDNA Clone; UXT cdna clone
Ordering
For Research Use Only!
Sequence
atggcgacgccccctaagcggcgggcggtggaggccacgggggagaaagtgctgcgctacgagaccttcatcagtgacgtgctgcagcgggacttgcgaaaggtgctggaccatcgagacaaggtatatgagcagctggccaaataccttcaactgagaaatgtcattgagcgactccaggaagctaagcactcggagttatatatgcaggtggatttgggctgtaacttcttcgttgacacagtggtcccagatacttcacgcatctatgtggccctgggatatggttttttcctggagttgacactggcagaagctctcaagttcattgatcgtaagagctctctcctcacagagctcagcaacagcctcaccaaggactccatgaatatcaaagcccatatccacatgttgctagaggggcttagagaactacaaggcctgcagaatttcccagagaagcctcaccattga
Sequence Length
474
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,246 Da
NCBI Official Full Name
Homo sapiens ubiquitously-expressed transcript, mRNA
NCBI Official Synonym Full Names
ubiquitously expressed prefoldin like chaperone
NCBI Official Symbol
UXT
NCBI Official Synonym Symbols
STAP1; ART-27
NCBI Protein Information
protein UXT
UniProt Protein Name
Protein UXT
Protein Family
UniProt Gene Name
UXT
UniProt Synonym Gene Names
ART-27
UniProt Entry Name
UXT_HUMAN

NCBI Description

The protein encoded by this gene functions as a cofactor that modulates androgen receptor-dependent transcription, and also plays a critical role in tumor necrosis factor-induced apoptosis. Expression of this gene may play a role in tumorigenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]

Uniprot Description

UXT: Involved in gene transcription regulation. Acts in concert with the corepressor URI1 to regulate androgen receptor transcription (AR). AR N-terminus-associated coactivator which may play a role in facilitating receptor-induced transcriptional activation (PubMed:11854421). Potential component of mitochondrial-associated LRPPRC, a multidomain organizer that potentially integrates mitochondria and the microtubular cytoskeleton with chromosome remodeling (PubMed:11827465). Increasing concentrations of UXT contributes to progressive aggregation of mitochondria and cell death potentially through its association with LRPPRC (PubMed:17554592). May be a nuclear chaperone that promotes formation of the NF-kappa-B enhanceosome and which is essential for its nuclear function (PubMed:17620405). Suppresses cell transformation and it might mediate this function by interaction and inhibition of the biological activity of cell proliferation and survival stimulatory factors like MECOM (PubMed:17635584). Together with URI1, associates with chromatin to the NKX3-1 promoter region. Belongs to the UXT family.

Protein type: Transcription, coactivator/corepressor; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: Xp11.23-p11.22

Cellular Component: centrosome; cytoplasm; cytoskeleton; gamma-tubulin complex; nucleus

Molecular Function: actin filament binding; beta-tubulin binding; chromatin binding; microtubule binding; protein binding

Biological Process: centrosome organization and biogenesis; microtubule cytoskeleton organization and biogenesis; mitochondrion transport along microtubule; negative regulation of transcription from RNA polymerase II promoter

Research Articles on UXT

Similar Products

Product Notes

The UXT uxt (Catalog #AAA1268890) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgacgc cccctaagcg gcgggcggtg gaggccacgg gggagaaagt gctgcgctac gagaccttca tcagtgacgt gctgcagcgg gacttgcgaa aggtgctgga ccatcgagac aaggtatatg agcagctggc caaatacctt caactgagaa atgtcattga gcgactccag gaagctaagc actcggagtt atatatgcag gtggatttgg gctgtaactt cttcgttgac acagtggtcc cagatacttc acgcatctat gtggccctgg gatatggttt tttcctggag ttgacactgg cagaagctct caagttcatt gatcgtaaga gctctctcct cacagagctc agcaacagcc tcaccaagga ctccatgaat atcaaagccc atatccacat gttgctagag gggcttagag aactacaagg cctgcagaat ttcccagaga agcctcacca ttga. It is sometimes possible for the material contained within the vial of "UXT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.