Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UTP3 cdna clone

UTP3 cDNA Clone

Gene Names
UTP3; CRL1; CRLZ1; SAS10
Synonyms
UTP3; UTP3 cDNA Clone; UTP3 cdna clone
Ordering
For Research Use Only!
Sequence
atggtggggagatcccggcggcgcggagcagctaagtgggcagctgtgcgagccaaggcaggtcccacgctcaccgacgaaaatggagatgatttaggattgccaccctcaccaggggacaccagctactaccaagatcaggtagatgactttcatgaggcacgatcccgggccgccttagctaagggctggaatgaagtacagagtggagacgaggaggatggcgaggaggaggaggaggaggtgctagccctagatatggacgatgaggacgacgaagatggagggaatgcgggggaggaggaggaggaggagaatgccgatgatgatggtgggagctccgtgcaaagtgaagctgaggcctctgtggatcccagtttgtcgtggggtcagaggaaaaaactttactatgacacggactatggttccaagtcccgaggccggcagagtcaacaggaggcagaggaggaggaaagagaggaggaggaggaggcacagatcattcagcggcgcctagcccaagcgctgcaagaggatgattttggtgtcgcctgggttgaggcctttgcaaaaccagtgcctcaggtagatgaggctgagacacgggtcgtgaaggatttggctaaagtttcagtgaaagagaagctgaaaatgttgcgaaaggaatcaccagaactcttggagctgatagaagacctgaaagtcaagttgacagaggttaaggatgagctggagccattgttagagttggtggaacaagggatcattccacccggaaaaggaagccaatacttgaggaccaagtacaacctctacttgaattattgctcgaacatcagtttttatttgatcctgaaagctaggagagtcccagcacatggacatcctgtcatagaaaggcttgttacctaccgaaatttgatcaacaagctgtccgttgtggatcagaagctgtcctcagaaattcgtcatctgttgacacttaaggatgatgctgtaaagaaagaactgattccaaaagcaaaatccaccaagcccaaaccaaagtctgtttcaaagacttctgctgctgcctgtgctgttacagatctttctgatgattctgattttgatgaaaaagcaaaactgaagtactataaagaaatagaagacaggcaaaagctaaagagaaagaaagaagaaaatagcactgaagaacaggctcttgaagatcaaaatgcaaagagagctattacctatcaaattgctaaaaataggggacttactcctaggagaaagaagattgatcgcaatcccagagtgaaacacagagagaagttcagaagagccaaaattagaagaagaggccaggttcgtgaagttcgtaaagaagagcaacgttatagtggtgaattatctggcattcgtgcaggagttaaaaagagcattaagcttaaatga
Sequence Length
1440
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,558 Da
NCBI Official Full Name
Homo sapiens UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
UTP3, small subunit processome component homolog (S. cerevisiae)
NCBI Official Symbol
UTP3
NCBI Official Synonym Symbols
CRL1; CRLZ1; SAS10
NCBI Protein Information
something about silencing protein 10
UniProt Protein Name
Something about silencing protein 10
UniProt Gene Name
UTP3
UniProt Synonym Gene Names
; CRL1
UniProt Entry Name
SAS10_HUMAN

Uniprot Description

SAS10: Essential for gene silencing: has a role in the structure of silenced chromatin. Plays a role in the developing brain. Belongs to the SAS10 family.

Protein type: RNA-binding

Chromosomal Location of Human Ortholog: 4q13.3

Cellular Component: nucleolus; nucleoplasm; nucleus; small subunit processome

Molecular Function: protein binding

Biological Process: brain development; maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA); rRNA processing

Research Articles on UTP3

Similar Products

Product Notes

The UTP3 utp3 (Catalog #AAA1271752) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgggga gatcccggcg gcgcggagca gctaagtggg cagctgtgcg agccaaggca ggtcccacgc tcaccgacga aaatggagat gatttaggat tgccaccctc accaggggac accagctact accaagatca ggtagatgac tttcatgagg cacgatcccg ggccgcctta gctaagggct ggaatgaagt acagagtgga gacgaggagg atggcgagga ggaggaggag gaggtgctag ccctagatat ggacgatgag gacgacgaag atggagggaa tgcgggggag gaggaggagg aggagaatgc cgatgatgat ggtgggagct ccgtgcaaag tgaagctgag gcctctgtgg atcccagttt gtcgtggggt cagaggaaaa aactttacta tgacacggac tatggttcca agtcccgagg ccggcagagt caacaggagg cagaggagga ggaaagagag gaggaggagg aggcacagat cattcagcgg cgcctagccc aagcgctgca agaggatgat tttggtgtcg cctgggttga ggcctttgca aaaccagtgc ctcaggtaga tgaggctgag acacgggtcg tgaaggattt ggctaaagtt tcagtgaaag agaagctgaa aatgttgcga aaggaatcac cagaactctt ggagctgata gaagacctga aagtcaagtt gacagaggtt aaggatgagc tggagccatt gttagagttg gtggaacaag ggatcattcc acccggaaaa ggaagccaat acttgaggac caagtacaac ctctacttga attattgctc gaacatcagt ttttatttga tcctgaaagc taggagagtc ccagcacatg gacatcctgt catagaaagg cttgttacct accgaaattt gatcaacaag ctgtccgttg tggatcagaa gctgtcctca gaaattcgtc atctgttgac acttaaggat gatgctgtaa agaaagaact gattccaaaa gcaaaatcca ccaagcccaa accaaagtct gtttcaaaga cttctgctgc tgcctgtgct gttacagatc tttctgatga ttctgatttt gatgaaaaag caaaactgaa gtactataaa gaaatagaag acaggcaaaa gctaaagaga aagaaagaag aaaatagcac tgaagaacag gctcttgaag atcaaaatgc aaagagagct attacctatc aaattgctaa aaatagggga cttactccta ggagaaagaa gattgatcgc aatcccagag tgaaacacag agagaagttc agaagagcca aaattagaag aagaggccag gttcgtgaag ttcgtaaaga agagcaacgt tatagtggtg aattatctgg cattcgtgca ggagttaaaa agagcattaa gcttaaatga. It is sometimes possible for the material contained within the vial of "UTP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.