USP5 cdna clone
USP5 cDNA Clone
Gene Names
USP5; ISOT
Synonyms
USP5; USP5 cDNA Clone; USP5 cdna clone
Sequence
atggcggagctgagtgaggaggcgctgctgtcagtattaccgacgatccgggtccctaaggctggagaccgggtccacaaagacgagtgcgccttctccttcgacacgccggagtctgaggggggcctctacatctgtatgaacacgtttctgggctttgggaaacagtatgtggagagacatttcaataagaccggccagcgagtctacttgcacctccggcggacccggcgcccgaaagaggaggaccctgctacaggcactggagacccaccccggaagaagcccacgcggctggctattggtgttgaaggcggatttgaccttagcgaggagaagtttgaattagacgaggatgtgaagattgtcattttgccagattacctggagattgcccgggatggactggggggactgcctgacattgtcagagatcgggtgaccagtgcagtggaggccctactgtcggccgactcagcctcccgcaagcaggaggtgcaggcatgggatggggaagtacggcaggtgtctaagcatgccttcagcctcaagcagttggacaaccctgctcgaatccctccctgtggctggaagtgctccaagtgtgacatgagagagaacctgtggctcaacctgactgatggctccatcctctgtgggcgacgctacttcgatggcagtgggggcaacaaccacgctgtggagcactaccgagagacaggctacccgttagctgtcaagctgggcaccatcacccctgatggagctgacgtgtactcatatgatgaggatgacatggtcctggaccccagcctggctgagcacctgtcccacttcggcatcgacatgctgaagatgcagaagacagacaagacgatgactgagttggagatagacatgaaccagcggattggtgaatgggagctgatccaggagtcaggtgtgccactcaagcccctgtttgggcctggctacacaggcatccggaacctgggtaacagctgctacctcaactctgtggtccaggtgctcttcagcatccctgacttccagaggaagtatgtggataagctggagaagatcttccagaatgccccgacggaccctacccaggatttcagcacccaggtggccaagctgggccatggccttctctccggggagtattccaagccagtaccggagtcgggcgatggggagcgggtgccagaacagaaggaagttcaagatggcattgcccctcggatgttcaaggccctcatcggcaagggccaccctgaattctccaccaaccggcagcaggatgcccaggagttcttccttcaccttatcaacatggtggagaggaattgccggagctctgaaaatcctaatgaagtgttccgcttcttggtggaggaaaagatcaagtgcctggccacagagaaggtgaagtacacccagcgagttgactacatcatgcagctgcctgtgcccatggatgcagcccttaacaaagaggagcttctggagtacgaggagaagaagcggcaagccgaagaggagaagatggcactgccagaactggttcgggcccaggtgcccttcagctcttgcctggaggcctacggggcccctgagcaggtcgatgacttctggagcacggccctgcaggccaagtcagtagctgtcaagaccacacgatttgcctcattccctgactacctggtcatccagatcaagaagttcaccttcggcttagactgggtgcccaagaaactggatgtgtccatcgagatgccagaggagctcgacatctcccagttgaggggcacagggctgcagcccggagaggaggagctgccagacattgccccacccctggtcactccggatgagcccaaagcgcccatgctggatgaatcagtcatcatccagctggtggagatgggattccctatggacgcctgccgcaaagctgtctactacacgggcaacagcggggctgaggccgccatgaactgggtcatgtcacacatggatgatccagattttgcaaaccccctcatcctgcctggctctagtgggccgggctccacaagcgcagcagccgacccccctcctgaggactgtgtgaccaccattgtctccatgggcttctcccgggaccaggccttgaaagcgctgcgggccacgaacaatagtttagaacgggctgtggactggatcttcagtcacattgacgacctggatgctgaagctgccatggacatctcagagggccgctcagctgccgactccatctctgagtctgtgccagtgggacctaaagtccgggatggtcctggaaagtatcagctctttgccttcattagtcacatgggcacctctaccatgtgtggtcactacgtctgccacatcaagaaagaaggcagatgggtgatctacaatgaccagaaagtgtgtgcctccgagaagccgcccaaggacctgggctacatctacttctaccagagagtggccagctaa
Sequence Length
2508
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
93,308 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 5 (isopeptidase T), mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 5
NCBI Official Symbol
USP5
NCBI Official Synonym Symbols
ISOT
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 5
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 5
UniProt Gene Name
USP5
UniProt Synonym Gene Names
ISOT
UniProt Entry Name
UBP5_HUMAN
NCBI Description
Ubiquitin (see MIM 191339)-dependent proteolysis is a complex pathway of protein metabolism implicated in such diverse cellular functions as maintenance of chromatin structure, receptor function, and degradation of abnormal proteins. A late step of the process involves disassembly of the polyubiquitin chains on degraded proteins into ubiquitin monomers. USP5 disassembles branched polyubiquitin chains by a sequential exo mechanism, starting at the proximal end of the chain (Wilkinson et al., 1995 [PubMed 7578059]).[supplied by OMIM, Mar 2010]
Uniprot Description
USP5: Cleaves linear and branched multiubiquitin polymers with a marked preference for branched polymers. Involved in unanchored 'Lys-48'-linked polyubiquitin disassembly. Binds linear and 'Lys- 63'-linked polyubiquitin with a lower affinity. Knock-down of USP5 causes the accumulation of p53/TP53 and an increase in p53/TP53 transcriptional activity because the unanchored polyubiquitin that accumulates is able to compete with ubiquitinated p53/TP53 but not with MDM2 for proteasomal recognition. Belongs to the peptidase C19 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Ubiquitin-specific protease; Protease; EC 3.4.19.12
Chromosomal Location of Human Ortholog: 12p13
Cellular Component: lysosome
Molecular Function: cysteine-type endopeptidase activity; protein binding; ubiquitin binding; ubiquitin-specific protease activity
Biological Process: positive regulation of proteasomal ubiquitin-dependent protein catabolic process; protein deubiquitination
Research Articles on USP5
Similar Products
Product Notes
The USP5 usp5 (Catalog #AAA1267398) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagc tgagtgagga ggcgctgctg tcagtattac cgacgatccg ggtccctaag gctggagacc gggtccacaa agacgagtgc gccttctcct tcgacacgcc ggagtctgag gggggcctct acatctgtat gaacacgttt ctgggctttg ggaaacagta tgtggagaga catttcaata agaccggcca gcgagtctac ttgcacctcc ggcggacccg gcgcccgaaa gaggaggacc ctgctacagg cactggagac ccaccccgga agaagcccac gcggctggct attggtgttg aaggcggatt tgaccttagc gaggagaagt ttgaattaga cgaggatgtg aagattgtca ttttgccaga ttacctggag attgcccggg atggactggg gggactgcct gacattgtca gagatcgggt gaccagtgca gtggaggccc tactgtcggc cgactcagcc tcccgcaagc aggaggtgca ggcatgggat ggggaagtac ggcaggtgtc taagcatgcc ttcagcctca agcagttgga caaccctgct cgaatccctc cctgtggctg gaagtgctcc aagtgtgaca tgagagagaa cctgtggctc aacctgactg atggctccat cctctgtggg cgacgctact tcgatggcag tgggggcaac aaccacgctg tggagcacta ccgagagaca ggctacccgt tagctgtcaa gctgggcacc atcacccctg atggagctga cgtgtactca tatgatgagg atgacatggt cctggacccc agcctggctg agcacctgtc ccacttcggc atcgacatgc tgaagatgca gaagacagac aagacgatga ctgagttgga gatagacatg aaccagcgga ttggtgaatg ggagctgatc caggagtcag gtgtgccact caagcccctg tttgggcctg gctacacagg catccggaac ctgggtaaca gctgctacct caactctgtg gtccaggtgc tcttcagcat ccctgacttc cagaggaagt atgtggataa gctggagaag atcttccaga atgccccgac ggaccctacc caggatttca gcacccaggt ggccaagctg ggccatggcc ttctctccgg ggagtattcc aagccagtac cggagtcggg cgatggggag cgggtgccag aacagaagga agttcaagat ggcattgccc ctcggatgtt caaggccctc atcggcaagg gccaccctga attctccacc aaccggcagc aggatgccca ggagttcttc cttcacctta tcaacatggt ggagaggaat tgccggagct ctgaaaatcc taatgaagtg ttccgcttct tggtggagga aaagatcaag tgcctggcca cagagaaggt gaagtacacc cagcgagttg actacatcat gcagctgcct gtgcccatgg atgcagccct taacaaagag gagcttctgg agtacgagga gaagaagcgg caagccgaag aggagaagat ggcactgcca gaactggttc gggcccaggt gcccttcagc tcttgcctgg aggcctacgg ggcccctgag caggtcgatg acttctggag cacggccctg caggccaagt cagtagctgt caagaccaca cgatttgcct cattccctga ctacctggtc atccagatca agaagttcac cttcggctta gactgggtgc ccaagaaact ggatgtgtcc atcgagatgc cagaggagct cgacatctcc cagttgaggg gcacagggct gcagcccgga gaggaggagc tgccagacat tgccccaccc ctggtcactc cggatgagcc caaagcgccc atgctggatg aatcagtcat catccagctg gtggagatgg gattccctat ggacgcctgc cgcaaagctg tctactacac gggcaacagc ggggctgagg ccgccatgaa ctgggtcatg tcacacatgg atgatccaga ttttgcaaac cccctcatcc tgcctggctc tagtgggccg ggctccacaa gcgcagcagc cgacccccct cctgaggact gtgtgaccac cattgtctcc atgggcttct cccgggacca ggccttgaaa gcgctgcggg ccacgaacaa tagtttagaa cgggctgtgg actggatctt cagtcacatt gacgacctgg atgctgaagc tgccatggac atctcagagg gccgctcagc tgccgactcc atctctgagt ctgtgccagt gggacctaaa gtccgggatg gtcctggaaa gtatcagctc tttgccttca ttagtcacat gggcacctct accatgtgtg gtcactacgt ctgccacatc aagaaagaag gcagatgggt gatctacaat gaccagaaag tgtgtgcctc cgagaagccg cccaaggacc tgggctacat ctacttctac cagagagtgg ccagctaa. It is sometimes possible for the material contained within the vial of "USP5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
