Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USP32 cdna clone

USP32 cDNA Clone

Gene Names
USP32; USP10; NY-REN-60
Synonyms
USP32; USP32 cDNA Clone; USP32 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtgccaaggagtcacggatcggattcctcagctacgaggaggcgctgaggagagttacagatgtagagctaaaacgactgaaggatgctttcaagaggacctgtggactctcatattacatgggccagcactgcttcatccgggaagtgcttggggatggagtgcctccaaaggttgctgaggtgatttactgttcttttggtggaacatccaaagggctgcacttcaataatttaatagttggacttgtcctccttacaagaggcaaagatgaagagaaagcaaaatacatttttagtcttttttcaagtgaatctgggaactatgttatacgggaagaaatggaaagaatgctccacgtggtggatggtaaagtcccagatacactcaggaagtgtttctcagagggtgaaaaggtaaactatgaaaagtttagaaattggctttttctaaacaaagatgcttttactttctctcgatggcttctatctggaggtgtgtatgttaccctcactgatgatagtgatactcctactttctaccaaactctggctggagtcacacatttggaggaatcagacatcattgatcttgagaaacgctattggttattgaaggctcaatcccggactggacgatttgatttagagacatttggcccattggtttcaccacctattcgtccatctctaagtgaaggtttgtttaatgcttttgatgaaaatcgtgacaatcacatagattttaaggagatatcctgtgggttatcagcctgttgcaggggacccctggctgaaagacaaaaattttgcttcaaggtatttgatgttgaccgtgatggagttctctccagggttgaactgagagacatggtggttgcacttttagaagtctggaaggacaaccgcactgatgatattcctgaattacatatggatctctctgatattgtagaaggcatactgaatgcacatgacaccacaaagatgggtcatcttactctggaagactatcagatctggagtgtgaaaaatgttcttgccaatgagtttttgaacctccttttccaggtgtgtcacatagttctggggttaagaccagctactccggaagaagaaggacaaattattaggactctggaaactgaccaaatatatacaagaaattga
Sequence Length
1173
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,703 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 32, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 32
NCBI Official Symbol
USP32
NCBI Official Synonym Symbols
USP10; NY-REN-60
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 32
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 32
UniProt Gene Name
USP32
UniProt Synonym Gene Names
USP10
UniProt Entry Name
UBP32_HUMAN

Uniprot Description

USP32: Belongs to the peptidase C19 family.

Protein type: Protease; Ubiquitin conjugating system; Ubiquitin-specific protease; EC 3.4.19.12

Chromosomal Location of Human Ortholog: 17q23.3

Cellular Component: cytoplasm; Golgi apparatus

Molecular Function: protein binding

Biological Process: protein deubiquitination

Research Articles on USP32

Similar Products

Product Notes

The USP32 usp32 (Catalog #AAA1275447) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtgcca aggagtcacg gatcggattc ctcagctacg aggaggcgct gaggagagtt acagatgtag agctaaaacg actgaaggat gctttcaaga ggacctgtgg actctcatat tacatgggcc agcactgctt catccgggaa gtgcttgggg atggagtgcc tccaaaggtt gctgaggtga tttactgttc ttttggtgga acatccaaag ggctgcactt caataattta atagttggac ttgtcctcct tacaagaggc aaagatgaag agaaagcaaa atacattttt agtctttttt caagtgaatc tgggaactat gttatacggg aagaaatgga aagaatgctc cacgtggtgg atggtaaagt cccagataca ctcaggaagt gtttctcaga gggtgaaaag gtaaactatg aaaagtttag aaattggctt tttctaaaca aagatgcttt tactttctct cgatggcttc tatctggagg tgtgtatgtt accctcactg atgatagtga tactcctact ttctaccaaa ctctggctgg agtcacacat ttggaggaat cagacatcat tgatcttgag aaacgctatt ggttattgaa ggctcaatcc cggactggac gatttgattt agagacattt ggcccattgg tttcaccacc tattcgtcca tctctaagtg aaggtttgtt taatgctttt gatgaaaatc gtgacaatca catagatttt aaggagatat cctgtgggtt atcagcctgt tgcaggggac ccctggctga aagacaaaaa ttttgcttca aggtatttga tgttgaccgt gatggagttc tctccagggt tgaactgaga gacatggtgg ttgcactttt agaagtctgg aaggacaacc gcactgatga tattcctgaa ttacatatgg atctctctga tattgtagaa ggcatactga atgcacatga caccacaaag atgggtcatc ttactctgga agactatcag atctggagtg tgaaaaatgt tcttgccaat gagtttttga acctcctttt ccaggtgtgt cacatagttc tggggttaag accagctact ccggaagaag aaggacaaat tattaggact ctggaaactg accaaatata tacaagaaat tga. It is sometimes possible for the material contained within the vial of "USP32, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.