Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USP21 cdna clone

USP21 cDNA Clone

Gene Names
USP21; USP16; USP23
Synonyms
USP21; USP21 cDNA Clone; USP21 cdna clone
Ordering
For Research Use Only!
Sequence
atgatatccgcccggtcctctgagcctttctactctgatgacaagatggctcatcacacactccttctgggctctggtcatgttggccttcgaaacctgggaaacacgtgcttcctgaatgctgtgctgcagtgtctgagcagcactcgacctcttcgggacttctgtctgagaagggacttccggcaagaggtgcctggaggaggccgagcccaagagctcactgaagcctttgcagatgtgattggtgccctctggcaccctgactcctgcgaagctgtgaatcctactcgattccgagctgtcttccagaaatatgttccctccttctctggatacagccagcaggatgcccaagagttcctgaagctcctcatggagcggctacaccttgaaatcaaccgccgaggccgccgggctccaccgatacttgccaatggtccagttccctctccaccccgccgaggaggggctctgctagaagaacctgagttaagtgatgatgaccgagccaacctaatgtggaaacgttacctggagcgagaggacagcaagattgtggacctgtttgtgggccagttgaaaagttgtctcaagtgccaggcctgtgggtatcgctccacgaccttcgaggttttttgtgacctgtccctgcccatccccaagaaaggatttgctgggggcaaggtgtctctgcgggattgtttcaaccttttcactaaggaagaagagctagagtcggagaatgccccagtgtgtgaccgatgtcggcagaaaactcgaagtaccaaaaagttgacagtacaaagattccctcgaatcctcgtgctccatctgaatcgattttctgcctcccgaggctccatcaaaaaaagttcagtaggtgtagactttccactgcagcgactgagcctaggggactttgccagtgacaaagccggaagtcctgtataccagctgtatgccctttgcaaccactcaggcagcgtccactatggccactacacagccctgtgccggtgccagactggttggcatgtctacaatgactctcgtgtctcccctgtcagtgaaaaccaggtggcatccagcgagggctacgtgctgttctaccaactgatgcaggagccaccccggtgcctgtga
Sequence Length
1146
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,122 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 21, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 21
NCBI Official Symbol
USP21
NCBI Official Synonym Symbols
USP16; USP23
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 21
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 21
UniProt Gene Name
USP21
UniProt Synonym Gene Names
USP23
UniProt Entry Name
UBP21_HUMAN

NCBI Description

This gene encodes a member of the C19 peptidase family, also known as family 2 of ubiquitin carboxy-terminal hydrolases. The encoded protein cleaves ubiquitin from ubiquitinated proteins for recycling in intracellular protein degradation. The encoded protein is also able to release NEDD8, a ubiquitin-like protein, from NEDD8-conjugated proteins. This gene has been referred to as USP16 and USP23 but is now known as USP21. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]

Uniprot Description

USP21: Deubiquitinates histone H2A, a specific tag for epigenetic transcriptional repression, thereby acting as a coactivator. Deubiquitination of histone H2A releaves the repression of di- and trimethylation of histone H3 at 'Lys-4', resulting in regulation of transcriptional initiation. Regulates gene expression via histone H2A deubiquitination. Also capable of removing NEDD8 from NEDD8 conjugates but has no effect on Sentrin-1 conjugates. Belongs to the peptidase C19 family. USP21 subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.4.19.12; Ubiquitin-specific protease; Ubiquitin conjugating system; Protease

Chromosomal Location of Human Ortholog: 1q22

Cellular Component: cytoplasm; nucleoplasm; plasma membrane

Molecular Function: cysteine-type peptidase activity; NEDD8-specific protease activity; protein binding; transcription coactivator activity; ubiquitin-specific protease activity

Biological Process: histone deubiquitination; positive regulation of transcription, DNA-dependent

Research Articles on USP21

Similar Products

Product Notes

The USP21 usp21 (Catalog #AAA1275740) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatatccg cccggtcctc tgagcctttc tactctgatg acaagatggc tcatcacaca ctccttctgg gctctggtca tgttggcctt cgaaacctgg gaaacacgtg cttcctgaat gctgtgctgc agtgtctgag cagcactcga cctcttcggg acttctgtct gagaagggac ttccggcaag aggtgcctgg aggaggccga gcccaagagc tcactgaagc ctttgcagat gtgattggtg ccctctggca ccctgactcc tgcgaagctg tgaatcctac tcgattccga gctgtcttcc agaaatatgt tccctccttc tctggataca gccagcagga tgcccaagag ttcctgaagc tcctcatgga gcggctacac cttgaaatca accgccgagg ccgccgggct ccaccgatac ttgccaatgg tccagttccc tctccacccc gccgaggagg ggctctgcta gaagaacctg agttaagtga tgatgaccga gccaacctaa tgtggaaacg ttacctggag cgagaggaca gcaagattgt ggacctgttt gtgggccagt tgaaaagttg tctcaagtgc caggcctgtg ggtatcgctc cacgaccttc gaggtttttt gtgacctgtc cctgcccatc cccaagaaag gatttgctgg gggcaaggtg tctctgcggg attgtttcaa ccttttcact aaggaagaag agctagagtc ggagaatgcc ccagtgtgtg accgatgtcg gcagaaaact cgaagtacca aaaagttgac agtacaaaga ttccctcgaa tcctcgtgct ccatctgaat cgattttctg cctcccgagg ctccatcaaa aaaagttcag taggtgtaga ctttccactg cagcgactga gcctagggga ctttgccagt gacaaagccg gaagtcctgt ataccagctg tatgcccttt gcaaccactc aggcagcgtc cactatggcc actacacagc cctgtgccgg tgccagactg gttggcatgt ctacaatgac tctcgtgtct cccctgtcag tgaaaaccag gtggcatcca gcgagggcta cgtgctgttc taccaactga tgcaggagcc accccggtgc ctgtga. It is sometimes possible for the material contained within the vial of "USP21, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.