Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

Test Data

USP18 cdna clone

USP18 cDNA Clone

Gene Names
USP18; ISG43; UBP43
Synonyms
USP18; USP18 cDNA Clone; USP18 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcaaggcgtttgggctcctgaggcaaatctgtcagtccatcctggctgagtcctcgcagtccccggcagatcttgaagaaaagaaggaagaagacagcaacatgaagagagagcagcccagagagcgtcccagggcctgggactaccctcatggcctggttggtttacacaacattggacagacctgctgccttaactccttgattcaggtgttcgtaatgaatgtggacttcaccaggatattgaagaggatcacggtgcccaggggagctgacgagcagaggagaagcgtccctttccagatgcttctgctgctggagaagatgcaggacagccggcagaaagcagtgcggcccctggagctggcctactgcctgcagaagtgcaacgtgcccttgtttgtccaacatgatgctgcccaactgtacctcaaactctggaacctgattaaggaccagatcactgatgtgcacttggtggagagactgcaggccctgtatacgatccgggtgaaggactccttgatttgcgttgactgtgccatggagagtagcagaaacagcagcatgctcaccctcccactttctctttttgatgtggactcaaagcccctgaagacactggaggacgccctgcactgcttcttccagcccagggagttatcaagcaaaagcaagtgcttctgtgagaactgtgggaagaagacccgtgggaaacaggtcttgaagctgacccatttgccccagaccctgacaatccacctcatgcgattctccatcaggaattcacagacgagaaagatctgccactccctgtacttcccccagagcttggatttcagccagatccttccaatgaagcgagagtcttgtgatgctgaggagcagtctggagggcagtatgagctttttgctgtgattgcgcacgtgggaatggcagactccggtcattactgtgtctacatccggaatgctgtggatggaaaatggttctgcttcaatgactccaatatttgcttggtgtcctgggaagacatccagtgtacctacggaaatcctaactaccactggcaggaaactgcatatcttctggtttacatgaagatggagtgctaa
Sequence Length
1119
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

Test Data

Test Data

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,352 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 18, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 18
NCBI Official Symbol
USP18
NCBI Official Synonym Symbols
ISG43; UBP43
NCBI Protein Information
ubl carboxyl-terminal hydrolase 18
UniProt Protein Name
Ubl carboxyl-terminal hydrolase 18
UniProt Gene Name
USP18
UniProt Synonym Gene Names
ISG43; hUBP43
UniProt Entry Name
UBP18_HUMAN

NCBI Description

The protein encoded by this gene belongs to the ubiquitin-specific proteases (UBP) family of enzymes that cleave ubiquitin from ubiquitinated protein substrates. It is highly expressed in liver and thymus, and is localized to the nucleus. This protein efficiently cleaves only ISG15 (a ubiquitin-like protein) fusions, and deletion of this gene in mice results in a massive increase of ISG15 conjugates in tissues, indicating that this protein is a major ISG15-specific protease. Mice lacking this gene are also hypersensitive to interferon, suggesting a function of this protein in downregulating interferon responses, independent of its isopeptidase activity towards ISG15. [provided by RefSeq, Sep 2011]

Uniprot Description

USP18: Can efficiently cleave only ISG15 fusions including native ISG15 conjugates linked via isopeptide bonds. Necessary to maintain a critical cellular balance of ISG15-conjugated proteins in both healthy and stressed organisms. Belongs to the peptidase C19 family.

Protein type: EC 3.4.19.-; Ubiquitin-specific protease; Protease; EC 3.1.2.-

Chromosomal Location of Human Ortholog: 22q11.21

Cellular Component: cytosol; nucleus

Molecular Function: ISG15-specific protease activity; protein binding; ubiquitin-specific protease activity

Research Articles on USP18

Similar Products

Product Notes

The USP18 usp18 (Catalog #AAA1268760) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcaagg cgtttgggct cctgaggcaa atctgtcagt ccatcctggc tgagtcctcg cagtccccgg cagatcttga agaaaagaag gaagaagaca gcaacatgaa gagagagcag cccagagagc gtcccagggc ctgggactac cctcatggcc tggttggttt acacaacatt ggacagacct gctgccttaa ctccttgatt caggtgttcg taatgaatgt ggacttcacc aggatattga agaggatcac ggtgcccagg ggagctgacg agcagaggag aagcgtccct ttccagatgc ttctgctgct ggagaagatg caggacagcc ggcagaaagc agtgcggccc ctggagctgg cctactgcct gcagaagtgc aacgtgccct tgtttgtcca acatgatgct gcccaactgt acctcaaact ctggaacctg attaaggacc agatcactga tgtgcacttg gtggagagac tgcaggccct gtatacgatc cgggtgaagg actccttgat ttgcgttgac tgtgccatgg agagtagcag aaacagcagc atgctcaccc tcccactttc tctttttgat gtggactcaa agcccctgaa gacactggag gacgccctgc actgcttctt ccagcccagg gagttatcaa gcaaaagcaa gtgcttctgt gagaactgtg ggaagaagac ccgtgggaaa caggtcttga agctgaccca tttgccccag accctgacaa tccacctcat gcgattctcc atcaggaatt cacagacgag aaagatctgc cactccctgt acttccccca gagcttggat ttcagccaga tccttccaat gaagcgagag tcttgtgatg ctgaggagca gtctggaggg cagtatgagc tttttgctgt gattgcgcac gtgggaatgg cagactccgg tcattactgt gtctacatcc ggaatgctgt ggatggaaaa tggttctgct tcaatgactc caatatttgc ttggtgtcct gggaagacat ccagtgtacc tacggaaatc ctaactacca ctggcaggaa actgcatatc ttctggttta catgaagatg gagtgctaa. It is sometimes possible for the material contained within the vial of "USP18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.