USE1 cdna clone
USE1 cDNA Clone
Gene Names
USE1; D12; P31; SLT1; MDS032
Synonyms
USE1; USE1 cDNA Clone; USE1 cdna clone
Sequence
atggcggcgtcgaggctggagctaaacctggtgcggctgctatcccgctgcgaggcgatggcagcggagaaacgggacccggacgagtggcgcctggagaagtacgtgggagccctagaggacatgttgcaggccctgaaggtccacgcgagcaaaccggcctctgaggtgatcaatgaatattcctggaaggtggattttctgaaggggatgctgcaagccgagaagctgacctcctcctcagagaaagcactggccaaccagttcctggcccctggccgtgtgccaaccacagccagagagcgagtgcccgccacaaagacggtgcatctgcagtcacgggcgcggtacaccagcgagatgcggagtgagctactaggcacggactctgcagagcctgagatggacgtaaggaagagaactggagtggcagggtcccagccagtgagtgagaagcagtcggcagctgagctagacctcgtcctgcagcgacatcagaacctccaggaaaagctggcggaagagatgctaggactggcccggagcctcaagaccaataccctggccgcccagagtgtcatcaagaaggacaaccagaccctgtcacactcactgaaaatggcggaccagaacctggagaaactgaagacggagtcagagcgtctggagcagcacacgcagaagtcagtcaactggctgctctgggccatgctcattatcgtctgcttcatcttcattagcatgatcctcttcattcgaatcatgcctaaactcaaataa
Sequence Length
780
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
15,063 Da
NCBI Official Full Name
Homo sapiens unconventional SNARE in the ER 1 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
unconventional SNARE in the ER 1
NCBI Official Symbol
USE1
NCBI Official Synonym Symbols
D12; P31; SLT1; MDS032
UniProt Protein Name
Vesicle transport protein USE1
Protein Family
UniProt Gene Name
USE1
UniProt Synonym Gene Names
USE1L
UniProt Entry Name
USE1_HUMAN
Uniprot Description
USE1L: SNARE that may be involved in targeting and fusion of Golgi-derived retrograde transport vesicles with the ER. Belongs to the USE1 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Vesicle; Membrane protein, integral
Chromosomal Location of Human Ortholog: 19p13.11
Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; lysosome
Molecular Function: protein binding
Biological Process: ER to Golgi vesicle-mediated transport; lysosomal transport; protein catabolic process; retrograde vesicle-mediated transport, Golgi to ER; secretion by cell
Similar Products
Product Notes
The USE1 use1 (Catalog #AAA1273261) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgt cgaggctgga gctaaacctg gtgcggctgc tatcccgctg cgaggcgatg gcagcggaga aacgggaccc ggacgagtgg cgcctggaga agtacgtggg agccctagag gacatgttgc aggccctgaa ggtccacgcg agcaaaccgg cctctgaggt gatcaatgaa tattcctgga aggtggattt tctgaagggg atgctgcaag ccgagaagct gacctcctcc tcagagaaag cactggccaa ccagttcctg gcccctggcc gtgtgccaac cacagccaga gagcgagtgc ccgccacaaa gacggtgcat ctgcagtcac gggcgcggta caccagcgag atgcggagtg agctactagg cacggactct gcagagcctg agatggacgt aaggaagaga actggagtgg cagggtccca gccagtgagt gagaagcagt cggcagctga gctagacctc gtcctgcagc gacatcagaa cctccaggaa aagctggcgg aagagatgct aggactggcc cggagcctca agaccaatac cctggccgcc cagagtgtca tcaagaagga caaccagacc ctgtcacact cactgaaaat ggcggaccag aacctggaga aactgaagac ggagtcagag cgtctggagc agcacacgca gaagtcagtc aactggctgc tctgggccat gctcattatc gtctgcttca tcttcattag catgatcctc ttcattcgaa tcatgcctaa actcaaataa. It is sometimes possible for the material contained within the vial of "USE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
