Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UQCRFS1 cdna clone

UQCRFS1 cDNA Clone

Gene Names
UQCRFS1; RIP1; RIS1; RISP; UQCR5
Synonyms
UQCRFS1; UQCRFS1 cDNA Clone; UQCRFS1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttgtcggtagcagcccgctcgggcccgttcgcgcccgtcctgtcggccacgtcccgcggggtggcgggcgcgctgcggcccttggtgcaggccacggtgcccgccaccccggagcagcctgtgttggacctgaagcggcccttcctcagccgggagtcgctgagcggccaggccgtgcgccggcctttggtcgcctccgtgggcctcaatgtccctgcttctgtttgttattcccacacagacatcaaggtgcctgacttctctgaataccgccgccttgaagttttagatagtacgaagtcttcaagagaaagcagcgaggctaggaaaggtttctcctatttggtaactggagtaactactgtgggtgtcgcatatgctgccaagaatgccgtcacccagttcgtttccagcatgagtgcttctgctgatgtgttggccctggcgaaaatcgaaatcaagttatctgatattccagaaggcaagaacatggctttcaaatggagaggcaaacccctgtttgtgcgtcatagaacccagaaggaaattgagcaggaagctgcagttgaattatcacagttgagggacccacagcatgatctagatcgagtaaagaaacctgaatgggttatcctgataggtgtttgcactcatcttggctgtgtacccattgcaaatgcaggagattttggtggttattactgcccttgccatgggtcacactatgatgcatctggcaggatcagattgggtcctgctcctctcaaccttgaagtccccacgtatgagttcaccagtgacgatatggtgattgttggttaa
Sequence Length
825
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,668 Da
NCBI Official Full Name
Homo sapiens ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1, mRNA
NCBI Official Synonym Full Names
ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
NCBI Official Symbol
UQCRFS1
NCBI Official Synonym Symbols
RIP1; RIS1; RISP; UQCR5
NCBI Protein Information
cytochrome b-c1 complex subunit Rieske, mitochondrial
UniProt Protein Name
Cytochrome b-c1 complex subunit Rieske, mitochondrial
Protein Family
UniProt Gene Name
UQCRFS1
UniProt Synonym Gene Names
RISP
UniProt Entry Name
UCRI_HUMAN

Uniprot Description

UQCRFS1: Component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is a respiratory chain that generates an electrochemical potential coupled to ATP synthesis.

Protein type: Oxidoreductase; Energy Metabolism - oxidative phosphorylation; Mitochondrial; EC 1.10.2.2

Chromosomal Location of Human Ortholog: 19q12

Cellular Component: mitochondrial inner membrane; mitochondrion

Biological Process: mitochondrial electron transport, ubiquinol to cytochrome c

Research Articles on UQCRFS1

Similar Products

Product Notes

The UQCRFS1 uqcrfs1 (Catalog #AAA1275189) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgtcgg tagcagcccg ctcgggcccg ttcgcgcccg tcctgtcggc cacgtcccgc ggggtggcgg gcgcgctgcg gcccttggtg caggccacgg tgcccgccac cccggagcag cctgtgttgg acctgaagcg gcccttcctc agccgggagt cgctgagcgg ccaggccgtg cgccggcctt tggtcgcctc cgtgggcctc aatgtccctg cttctgtttg ttattcccac acagacatca aggtgcctga cttctctgaa taccgccgcc ttgaagtttt agatagtacg aagtcttcaa gagaaagcag cgaggctagg aaaggtttct cctatttggt aactggagta actactgtgg gtgtcgcata tgctgccaag aatgccgtca cccagttcgt ttccagcatg agtgcttctg ctgatgtgtt ggccctggcg aaaatcgaaa tcaagttatc tgatattcca gaaggcaaga acatggcttt caaatggaga ggcaaacccc tgtttgtgcg tcatagaacc cagaaggaaa ttgagcagga agctgcagtt gaattatcac agttgaggga cccacagcat gatctagatc gagtaaagaa acctgaatgg gttatcctga taggtgtttg cactcatctt ggctgtgtac ccattgcaaa tgcaggagat tttggtggtt attactgccc ttgccatggg tcacactatg atgcatctgg caggatcaga ttgggtcctg ctcctctcaa ccttgaagtc cccacgtatg agttcaccag tgacgatatg gtgattgttg gttaa. It is sometimes possible for the material contained within the vial of "UQCRFS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.