Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ULBP2 cdna clone

ULBP2 cDNA Clone

Gene Names
ULBP2; N2DL2; RAET1H; NKG2DL2; ALCAN-alpha
Synonyms
ULBP2; ULBP2 cDNA Clone; ULBP2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagcagccgccgctaccaagatccttctgtgcctcccgcttctgctcctgctgtccggctggtcccgggctgggcgagccgaccctcactctctttgctatgacatcaccgtcatccctaagttcagacctggaccacggtggtgtgcggttcaaggccaggtggatgaaaagacttttcttcactatgactgtggcaacaagacagtcacacctgtcagtcccctggggaagaaactaaatgtcacaacggcctggaaagcacagaacccagtactgagagaggtggtggacatacttacagagcaactgcgtgacattcagctggagaattacacacccaaggaacccctcaccctgcaggccaggatgtcttgtgagcagaaagctgaaggacacagcagtggatcttggcagttcagtttcgatgggcagatcttcctcctctttgactcagagaagagaatgtggacaacggttcatcctggagccagaaagatgaaagaaaagtgggagaatgacaaggttgtggccatgtccttccattacttctcaatgggagactgtataggatggcttgaggacttcttgatgggcatggacagcaccctggagccaagtgcaggagcaccactcgccatgtcctcaggcacaacccaactcagggccacagccaccaccctcatcctttgctgcctcctcatcatcctcccctgcttcatcctccctggcatctga
Sequence Length
741
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,368 Da
NCBI Official Full Name
Homo sapiens UL16 binding protein 2, mRNA
NCBI Official Synonym Full Names
UL16 binding protein 2
NCBI Official Symbol
ULBP2
NCBI Official Synonym Symbols
N2DL2; RAET1H; NKG2DL2; ALCAN-alpha
NCBI Protein Information
NKG2D ligand 2
UniProt Protein Name
NKG2D ligand 2
Protein Family
UniProt Gene Name
ULBP2
UniProt Synonym Gene Names
N2DL2; RAET1H; N2DL-2; NKG2DL2
UniProt Entry Name
N2DL2_HUMAN

NCBI Description

This gene encodes a major histocompatibility complex (MHC) class I-related molecule that binds to the NKG2D receptor on natural killer (NK) cells to trigger release of multiple cytokines and chemokines that in turn contribute to the recruitment and activation of NK cells. The encoded protein undergoes further processing to generate the mature protein that is either anchored to membrane via a glycosylphosphatidylinositol moiety, or secreted. Many malignant cells secrete the encoded protein to evade immunosurveillance by NK cells. This gene is located in a cluster of multiple MHC class I-related genes on chromosome 6. [provided by RefSeq, Jul 2015]

Uniprot Description

ULBP2: Ligand for the NKG2D receptor, together with at least ULBP1 and ULBP3. ULBPs activate multiple signaling pathways in primary NK cells, resulting in the production of cytokines and chemokines. Binding of ULBPs ligands to NKG2D induces calcium mobilization and activation of the JAK2, STAT5, ERK and PI3K kinase/Akt signal transduction pathway. In CMV infected cells, interacts with soluble CMV glycoprotein UL16. The interaction with UL16 blocked the interaction with the NKG2D receptor, providing a mechanism by which CMV infected cells might escape the immune system. UL16 also causes ULBP2 to be retained in the ER and cis- Golgi apparatus so that it does not reach the cell surface. Belongs to the MHC class I family.

Protein type: Membrane protein, GPI anchor

Chromosomal Location of Human Ortholog: 6q25

Cellular Component: anchored to plasma membrane; cell surface; extracellular space

Molecular Function: antigen binding; natural killer cell lectin-like receptor binding

Biological Process: antigen processing and presentation; natural killer cell activation; natural killer cell mediated cytotoxicity

Research Articles on ULBP2

Similar Products

Product Notes

The ULBP2 ulbp2 (Catalog #AAA1277645) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcag ccgccgctac caagatcctt ctgtgcctcc cgcttctgct cctgctgtcc ggctggtccc gggctgggcg agccgaccct cactctcttt gctatgacat caccgtcatc cctaagttca gacctggacc acggtggtgt gcggttcaag gccaggtgga tgaaaagact tttcttcact atgactgtgg caacaagaca gtcacacctg tcagtcccct ggggaagaaa ctaaatgtca caacggcctg gaaagcacag aacccagtac tgagagaggt ggtggacata cttacagagc aactgcgtga cattcagctg gagaattaca cacccaagga acccctcacc ctgcaggcca ggatgtcttg tgagcagaaa gctgaaggac acagcagtgg atcttggcag ttcagtttcg atgggcagat cttcctcctc tttgactcag agaagagaat gtggacaacg gttcatcctg gagccagaaa gatgaaagaa aagtgggaga atgacaaggt tgtggccatg tccttccatt acttctcaat gggagactgt ataggatggc ttgaggactt cttgatgggc atggacagca ccctggagcc aagtgcagga gcaccactcg ccatgtcctc aggcacaacc caactcaggg ccacagccac caccctcatc ctttgctgcc tcctcatcat cctcccctgc ttcatcctcc ctggcatctg a. It is sometimes possible for the material contained within the vial of "ULBP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.