UEVLD cdna clone
UEVLD cDNA Clone
Gene Names
UEVLD; ATTP; UEV3
Synonyms
UEVLD; UEVLD cDNA Clone; UEVLD cdna clone
Sequence
atggagttcgactgcgagggcctgagacggctgcttggcaagtacaagttcagggacctaactgtggaagaactaaggaatgtaaatgtatttttcccacatttcaaatattccatggacacctatggtaatacatataacataccaattcgtttctggattttggattctcaccctttcgctccccctatttgcttcttgaagccaactgcaaatatgggaatcttagtcggaaaacatgtggatgctcaaggcagaatatatttgccctatctccaaaactggagccatcctaaatctgtcattgttggattaattaaagaaatgattgccaagtttcaagaggaacttcccatgtattctctatcatcatctgatgaggcacggcaggtagacttgctagcctatattgcaaaaatcactgaaggtgtttcagatacaaattcaaagagctgggcaaatcatgagaataaaacagtcaataaaattactgtggttggaggtggagaactcggtattgcctgcacattagcaatttcagcaaagggtattgcagacaggcttgtcctcttagacctctcagaagggactaaaggagccacgatggaccttgaaatcttcaaccttcctaatgtggagatcagcaaagatttgtctgcctctgctcattccaaggtggtgatcttcacagtcaactctttgggtagttctcagtcgtaccttgatgtggtacagagcaatgtggatatgttcagagcccttgtcccagctctgggacattatagtcaacacagtgtcctgctcgttgcatctcaaccagtggaaatcatgacctatgtaacatggaaactgagtacatttcctgcaaatcgagtgatcggaattggatgtaatctggattcacagagattacagtatattattacaaatgttttgaaggcacagacttcaggcaaagaagtatgggttattggcgagcaaggagaagacaaagtgctcacatggagtggccaagaagaagtagtgagtcatacctctcaagtgcagctgtccaacagggatattatgatataa
Sequence Length
1074
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
22,240 Da
NCBI Official Full Name
Homo sapiens UEV and lactate/malate dehyrogenase domains, mRNA
NCBI Official Synonym Full Names
UEV and lactate/malate dehyrogenase domains
NCBI Official Symbol
UEVLD
NCBI Official Synonym Symbols
ATTP; UEV3
NCBI Protein Information
ubiquitin-conjugating enzyme E2 variant 3
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 variant 3
UniProt Gene Name
UEVLD
UniProt Synonym Gene Names
UEV-3
UniProt Entry Name
UEVLD_HUMAN
Uniprot Description
UEVLD: Possible negative regulator of polyubiquitination. 5 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 11p15.1
Research Articles on UEVLD
Similar Products
Product Notes
The UEVLD uevld (Catalog #AAA1272265) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagttcg actgcgaggg cctgagacgg ctgcttggca agtacaagtt cagggaccta actgtggaag aactaaggaa tgtaaatgta tttttcccac atttcaaata ttccatggac acctatggta atacatataa cataccaatt cgtttctgga ttttggattc tcaccctttc gctcccccta tttgcttctt gaagccaact gcaaatatgg gaatcttagt cggaaaacat gtggatgctc aaggcagaat atatttgccc tatctccaaa actggagcca tcctaaatct gtcattgttg gattaattaa agaaatgatt gccaagtttc aagaggaact tcccatgtat tctctatcat catctgatga ggcacggcag gtagacttgc tagcctatat tgcaaaaatc actgaaggtg tttcagatac aaattcaaag agctgggcaa atcatgagaa taaaacagtc aataaaatta ctgtggttgg aggtggagaa ctcggtattg cctgcacatt agcaatttca gcaaagggta ttgcagacag gcttgtcctc ttagacctct cagaagggac taaaggagcc acgatggacc ttgaaatctt caaccttcct aatgtggaga tcagcaaaga tttgtctgcc tctgctcatt ccaaggtggt gatcttcaca gtcaactctt tgggtagttc tcagtcgtac cttgatgtgg tacagagcaa tgtggatatg ttcagagccc ttgtcccagc tctgggacat tatagtcaac acagtgtcct gctcgttgca tctcaaccag tggaaatcat gacctatgta acatggaaac tgagtacatt tcctgcaaat cgagtgatcg gaattggatg taatctggat tcacagagat tacagtatat tattacaaat gttttgaagg cacagacttc aggcaaagaa gtatgggtta ttggcgagca aggagaagac aaagtgctca catggagtgg ccaagaagaa gtagtgagtc atacctctca agtgcagctg tccaacaggg atattatgat ataa. It is sometimes possible for the material contained within the vial of "UEVLD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
