Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UCKL1 cdna clone

UCKL1 cDNA Clone

Gene Names
UCKL1; UCK1L; URKL1
Synonyms
UCKL1; UCKL1 cDNA Clone; UCKL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcgcccccggcccgcgcggacgctgatccttcgcccacgtcgccacctacggcccgagacacaccaggccggcaggctgagaaaagcgagaccgcgtgcgaggaccgcagcaatgcagagtccctggacaggctcctgccacctgtgggcactgggcgctctccccggaagcggaccaccagccagtgcaagtcagagcctcccctgctgcgtacaagcaagcgtaccatctacaccgccgggcggccgccctggtacaatgaacacggcacgcaatccaaagaggccttcgccatcggcttgggaggcggcagtgcctctgggaagaccactgtggccagaatgatcatcgaggccctggatgtgccctgggtggtcttgctgtccatggactccttctacaaggtgctgactgagcagcagcaggaacaggccgcacacaacaacttcaacttcgaccacccagatgcctttgacttcgacctcatcatttccaccctcaagaagctgaagcaggggaagagtgtcaaggtgcccatttatgacttcaccacgcacagccggaagaaggactggaaaacactgtatggtgcaaacgtcatcatctttgagggcatcatggcctttgctgacaagacactgttggagctcctggacatgaagatctttgtggacacagactccgacatccgcctggtacggcggctgcgccgggacatcagtgagcgcggccgggacatcgagggtgtcatcaagcagtacaacaagtttgtcaagccctccttcgaccagtacatccagcccaccatgcgcctggcagacatcgtggtccccagagggagcggcaacacggtcgccatcgacctgattgtgcagcacgtgcacagccagctggaggagggctgcgctggcctcggcacaccagtgccacccgctgccccggacgctgagcgtcctgaagagcacgccgcaggtacggggcatgcacaccatcatcaggtgagggcccacctggggacggggcggccccgggcgcgtgctcccgctcaactgttggccccacagggacaaggagaccagtcgcgacgagttcatcttctactccaagagactgatgcggctgctcatcgagcacgcgctctccttcctgccctttcaggactgcgtcgtacagaccccgcaggggcaggactatgcgggcaagtgctatgcggggaagcagatcaccggtgtgtccattctgcgcgccggtga
Sequence Length
1260
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,466 Da
NCBI Official Full Name
Homo sapiens uridine-cytidine kinase 1-like 1, mRNA
NCBI Official Synonym Full Names
uridine-cytidine kinase 1 like 1
NCBI Official Symbol
UCKL1
NCBI Official Synonym Symbols
UCK1L; URKL1
NCBI Protein Information
uridine-cytidine kinase-like 1
UniProt Protein Name
Uridine-cytidine kinase-like 1
Protein Family
UniProt Gene Name
UCKL1
UniProt Synonym Gene Names
URKL1
UniProt Entry Name
UCKL1_HUMAN

NCBI Description

The protein encoded by this gene is a uridine kinase. Uridine kinases catalyze the phosphorylation of uridine to uridine monophosphate. This protein has been shown to bind to Epstein-Barr nuclear antigen 3 as well as natural killer lytic-associated molecule. Ubiquitination of this protein is enhanced by the presence of natural killer lytic-associated molecule. In addition, protein levels decrease in the presence of natural killer lytic-associated molecule, suggesting that association with natural killer lytic-associated molecule results in ubiquitination and subsequent degradation of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

Uniprot Description

UCKL1: May contribute to UTP accumulation needed for blast transformation and proliferation. Belongs to the uridine kinase family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleotide Metabolism - pyrimidine; EC 2.7.1.48; Xenobiotic Metabolism - drug metabolism - other enzymes; Transferase

Chromosomal Location of Human Ortholog: 20q13.33

Cellular Component: cytosol

Molecular Function: protein binding; uridine kinase activity

Biological Process: pyrimidine base metabolic process; pyrimidine nucleoside salvage

Research Articles on UCKL1

Similar Products

Product Notes

The UCKL1 uckl1 (Catalog #AAA1271154) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcgc ccccggcccg cgcggacgct gatccttcgc ccacgtcgcc acctacggcc cgagacacac caggccggca ggctgagaaa agcgagaccg cgtgcgagga ccgcagcaat gcagagtccc tggacaggct cctgccacct gtgggcactg ggcgctctcc ccggaagcgg accaccagcc agtgcaagtc agagcctccc ctgctgcgta caagcaagcg taccatctac accgccgggc ggccgccctg gtacaatgaa cacggcacgc aatccaaaga ggccttcgcc atcggcttgg gaggcggcag tgcctctggg aagaccactg tggccagaat gatcatcgag gccctggatg tgccctgggt ggtcttgctg tccatggact ccttctacaa ggtgctgact gagcagcagc aggaacaggc cgcacacaac aacttcaact tcgaccaccc agatgccttt gacttcgacc tcatcatttc caccctcaag aagctgaagc aggggaagag tgtcaaggtg cccatttatg acttcaccac gcacagccgg aagaaggact ggaaaacact gtatggtgca aacgtcatca tctttgaggg catcatggcc tttgctgaca agacactgtt ggagctcctg gacatgaaga tctttgtgga cacagactcc gacatccgcc tggtacggcg gctgcgccgg gacatcagtg agcgcggccg ggacatcgag ggtgtcatca agcagtacaa caagtttgtc aagccctcct tcgaccagta catccagccc accatgcgcc tggcagacat cgtggtcccc agagggagcg gcaacacggt cgccatcgac ctgattgtgc agcacgtgca cagccagctg gaggagggct gcgctggcct cggcacacca gtgccacccg ctgccccgga cgctgagcgt cctgaagagc acgccgcagg tacggggcat gcacaccatc atcaggtgag ggcccacctg gggacggggc ggccccgggc gcgtgctccc gctcaactgt tggccccaca gggacaagga gaccagtcgc gacgagttca tcttctactc caagagactg atgcggctgc tcatcgagca cgcgctctcc ttcctgccct ttcaggactg cgtcgtacag accccgcagg ggcaggacta tgcgggcaag tgctatgcgg ggaagcagat caccggtgtg tccattctgc gcgccggtga. It is sometimes possible for the material contained within the vial of "UCKL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.