UBOX5 cdna clone
UBOX5 cDNA Clone
Gene Names
UBOX5; UIP5; RNF37; hUIP5; UBCE7IP5
Synonyms
UBOX5; UBOX5 cDNA Clone; UBOX5 cdna clone
Sequence
atggtaataaatctttgcctcccacagttcagaccaagaattcactgcaacaagatatcagctgatggttacgaagtagaaaatctcatctctgaagatctcacaaagagaagtcatggtttcaggacagagtatttcattaagccaccagtctatgtgacagtttcatttccctttaatgtggaaatctgtaggatcaacatagacctcacagctgggggaggtcagaacgtcactggcctggaaatgtacacatctgcctcatctagcagagtgtcttggaatacgccccagtgccggaccctgggcccagctgagccatctgtcccagacaaggaggcgttcaccttggtaggcaaagtcttactgaaaaaccagagccaagtggtgtttagccacaggggcttcaaggccaggcccccttttggcgcgatggaagccacactcccctcccctgctgttgtggcccaggagctctggaataaaggggctctttcccttagccacgtggcccacttaaggatctgtatcacccatgtgacaggcggcggtatcccttgtatcaagcggttggaagtgtggggtcagccggccaagacctgctcccaggaagtgatagacagcatcctgctggtcacctcagagaacctgcctcaggatgtggctctgcaggctccagccttgcccatggaaagtgactgtgaccctggggaccagcctgagagccagcaggctccctccagcctgcagaagctggccgagatcattcaggatgtgcctgaggagttcctggatcccatcaccctggagatcatgccttgtcccatgctgctgccctcaggcaaggtcatcgaccagagcacactggagaagtgtaaccgcagtgaagccacatggggccgagtgcccagtgaccctttcacgggggtagcttttactccgcactctcagcccctgcctcacccctccctcaaggcccggattgaccatttcctgctccagcactccatccctggctgccacctgcttgggagagcacagacggcattggcagtgatcccttcttccattgttctgccctctcagaaaaggaagatagagcaggctgaacatgtcccagacagtaactttggtgtaaatgcttcctgtttttctgccacaagccctttggtcttacccactacctcagagcacactgctaagaaaatgaaagccaccaatgagcccagcctgacacatatggactgctcgacaggtccactgtcccacgagcagaagctgtcacaaagcttggaaattgccttggcatccacccttggctctatgccctccttcacggcacggctgaccaggggacagctccagcaccttggcacaagagggagcaacacttcctggaggcctggcaccggctcggagcagcctgggagcatcctgggccccgaatgtgcctcctgcaaaagagtattttctccctacttcaaaaaggagccggtgtaccagctgccctgcggccacctcctgtgccgaccctgcctgggtgagaagcaacgctccctgcccatgacgtgcacagcctgccagcggccggttgctagccaagacgtgctgcgggtccacttctga
Sequence Length
1626
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
53,276 Da
NCBI Official Full Name
Homo sapiens U-box domain containing 5, mRNA
NCBI Official Synonym Full Names
U-box domain containing 5
NCBI Official Symbol
UBOX5
NCBI Official Synonym Symbols
UIP5; RNF37; hUIP5; UBCE7IP5
NCBI Protein Information
RING finger protein 37
UniProt Protein Name
RING finger protein 37
Protein Family
UniProt Gene Name
UBOX5
UniProt Synonym Gene Names
hUIP5
UniProt Entry Name
RNF37_HUMAN
NCBI Description
This gene encodes a U-box domain containing protein. The encoded protein interacts with E2 enzymes and may play a role in the ubiquitination pathway. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Uniprot Description
UBOX5: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Ubiquitin conjugating system; Ubiquitin ligase
Chromosomal Location of Human Ortholog: 20p13
Cellular Component: nuclear body; nucleus
Molecular Function: protein binding; ubiquitin protein ligase binding
Biological Process: protein polyubiquitination
Similar Products
Product Notes
The UBOX5 ubox5 (Catalog #AAA1267091) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtaataa atctttgcct cccacagttc agaccaagaa ttcactgcaa caagatatca gctgatggtt acgaagtaga aaatctcatc tctgaagatc tcacaaagag aagtcatggt ttcaggacag agtatttcat taagccacca gtctatgtga cagtttcatt tccctttaat gtggaaatct gtaggatcaa catagacctc acagctgggg gaggtcagaa cgtcactggc ctggaaatgt acacatctgc ctcatctagc agagtgtctt ggaatacgcc ccagtgccgg accctgggcc cagctgagcc atctgtccca gacaaggagg cgttcacctt ggtaggcaaa gtcttactga aaaaccagag ccaagtggtg tttagccaca ggggcttcaa ggccaggccc ccttttggcg cgatggaagc cacactcccc tcccctgctg ttgtggccca ggagctctgg aataaagggg ctctttccct tagccacgtg gcccacttaa ggatctgtat cacccatgtg acaggcggcg gtatcccttg tatcaagcgg ttggaagtgt ggggtcagcc ggccaagacc tgctcccagg aagtgataga cagcatcctg ctggtcacct cagagaacct gcctcaggat gtggctctgc aggctccagc cttgcccatg gaaagtgact gtgaccctgg ggaccagcct gagagccagc aggctccctc cagcctgcag aagctggccg agatcattca ggatgtgcct gaggagttcc tggatcccat caccctggag atcatgcctt gtcccatgct gctgccctca ggcaaggtca tcgaccagag cacactggag aagtgtaacc gcagtgaagc cacatggggc cgagtgccca gtgacccttt cacgggggta gcttttactc cgcactctca gcccctgcct cacccctccc tcaaggcccg gattgaccat ttcctgctcc agcactccat ccctggctgc cacctgcttg ggagagcaca gacggcattg gcagtgatcc cttcttccat tgttctgccc tctcagaaaa ggaagataga gcaggctgaa catgtcccag acagtaactt tggtgtaaat gcttcctgtt tttctgccac aagccctttg gtcttaccca ctacctcaga gcacactgct aagaaaatga aagccaccaa tgagcccagc ctgacacata tggactgctc gacaggtcca ctgtcccacg agcagaagct gtcacaaagc ttggaaattg ccttggcatc cacccttggc tctatgccct ccttcacggc acggctgacc aggggacagc tccagcacct tggcacaaga gggagcaaca cttcctggag gcctggcacc ggctcggagc agcctgggag catcctgggc cccgaatgtg cctcctgcaa aagagtattt tctccctact tcaaaaagga gccggtgtac cagctgccct gcggccacct cctgtgccga ccctgcctgg gtgagaagca acgctccctg cccatgacgt gcacagcctg ccagcggccg gttgctagcc aagacgtgct gcgggtccac ttctga. It is sometimes possible for the material contained within the vial of "UBOX5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
