Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2T cdna clone

UBE2T cDNA Clone

Gene Names
UBE2T; FANCT; PIG50; HSPC150
Synonyms
UBE2T; UBE2T cDNA Clone; UBE2T cdna clone
Ordering
For Research Use Only!
Sequence
atgcagagagcttcacgtctgaagagagagctgcacatgttagccacagagccacccccaggcatcacatgttggcaagataaagaccaaatggatgacctgcgagctcaaatattaggtggagccaacacaccttatgagaaaggtgtttttaagctagaagttatcattcctgagaggtacccatttgaacctcctcagatccgatttctcactccaatttatcatccaaacattgattctgctggaaggatttgtctggatgttctcaaattgccaccaaaaggtgcttggagaccatccctcaacatcgcaactgtgttgacctctattcagctgctcatgtcagaacccaaccctgatgacccgctcatggctgacatatcctcagaatttaaatataataagccagccttcctcaagaatgccagacagtggacagagaagcatgcaagacagaaacaaaaggctgatgaggaagagatgcttgataatctaccagaggctggtgactccagagtacacaactcaacacagaaaaggaaggccagtcagctagtaggcatagaaaagaaatttcatcctgatgtttag
Sequence Length
594
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,521 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2T (putative), mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 T
NCBI Official Symbol
UBE2T
NCBI Official Synonym Symbols
FANCT; PIG50; HSPC150
NCBI Protein Information
ubiquitin-conjugating enzyme E2 T
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 T
UniProt Gene Name
UBE2T
UniProt Entry Name
UBE2T_HUMAN

NCBI Description

The protein encoded by this gene catalyzes the covalent attachment of ubiquitin to protein substrates. Defects in this gene have been associated with Fanconi anemia of complementation group T. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]

Uniprot Description

UBE2T: Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. Catalyzes monoubiquitination. Involved in mitomycin-C (MMC)-induced DNA repair: acts as a specific E2 ubiquitin-conjugating enzyme for the Fanconi anemia complex by associating with E3 ubiquitin-protein ligase FANCL and catalyzing monoubiquitination of FANCD2, a key step in the DNA damage pathway. Also mediates monoubiquitination of FANCL and FANCI. May contribute to ubiquitination and degradation of BRCA1. In vitro able to promote polyubiquitination using all 7 ubiquitin Lys residues, but may prefer 'Lys-11'-, 'Lys-27'-, 'Lys-48'- and 'Lys-63'-linked polyubiquitination. Belongs to the ubiquitin-conjugating enzyme family.

Protein type: Ubiquitin conjugating system; Ubiquitin ligase; EC 6.3.2.19; Ligase

Chromosomal Location of Human Ortholog: 1q32.1

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: chromatin binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: DNA repair; protein autoubiquitination; protein monoubiquitination; response to DNA damage stimulus

Disease: Fanconi Anemia, Complementation Group T

Research Articles on UBE2T

Similar Products

Product Notes

The UBE2T ube2t (Catalog #AAA1272096) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagagag cttcacgtct gaagagagag ctgcacatgt tagccacaga gccaccccca ggcatcacat gttggcaaga taaagaccaa atggatgacc tgcgagctca aatattaggt ggagccaaca caccttatga gaaaggtgtt tttaagctag aagttatcat tcctgagagg tacccatttg aacctcctca gatccgattt ctcactccaa tttatcatcc aaacattgat tctgctggaa ggatttgtct ggatgttctc aaattgccac caaaaggtgc ttggagacca tccctcaaca tcgcaactgt gttgacctct attcagctgc tcatgtcaga acccaaccct gatgacccgc tcatggctga catatcctca gaatttaaat ataataagcc agccttcctc aagaatgcca gacagtggac agagaagcat gcaagacaga aacaaaaggc tgatgaggaa gagatgcttg ataatctacc agaggctggt gactccagag tacacaactc aacacagaaa aggaaggcca gtcagctagt aggcatagaa aagaaatttc atcctgatgt ttag. It is sometimes possible for the material contained within the vial of "UBE2T, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.