Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2R2 cdna clone

UBE2R2 cDNA Clone

Gene Names
UBE2R2; UBC3B; CDC34B; E2-CDC34B
Synonyms
UBE2R2; UBE2R2 cDNA Clone; UBE2R2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccagcagcagatgaccagctcgcagaaggccctgatgctcgagctgaaatccctgcaggaggaaccggtggagggcttccggatcaccctggtggacgagtccgacctctacaactgggaggtggccatcttcggaccccccaacaccctctacgaaggcggctacttcaaggcgcatattaaatttcctattgactacccctattcaccacctaccttcagattcttgaccaaaatgtggcaccccaacatttatgagaatggagatgtatgcatttcgattcttcatccgcctgtagatgacccacagagtggagaactgccttctgaaaggtggaatcctactcagaatgtgaggactatcctattaagtgtaatctcactgcttaatgagcccaacaccttctccccagccaatgtcgatgcttcagttatgttcaggaaatggagagacagtaaaggaaaagacaaagaatatgctgaaattattaggaaacaagtttcagccactaaggccgaagcagaaaaggatggagtgaaggtccccacaaccctggcggaatactgcatcaaaactaaagtgccttccaatgacaacagctcagatttgctttacgacgacttgtatgatgacgacattgatgatgaagatgaggaggaggaagatgccgactgttatgatgatgatgattctgggaatgaggagtcgtga
Sequence Length
717
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,166 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2R 2, mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 R2
NCBI Official Symbol
UBE2R2
NCBI Official Synonym Symbols
UBC3B; CDC34B; E2-CDC34B
NCBI Protein Information
ubiquitin-conjugating enzyme E2 R2
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 R2
UniProt Gene Name
UBE2R2
UniProt Synonym Gene Names
CDC34B; UBC3B
UniProt Entry Name
UB2R2_HUMAN

NCBI Description

Protein kinase CK2 is a ubiquitous and pleiotropic Ser/Thr protein kinase involved in cell growth and transformation. This gene encodes a protein similar to the E2 ubiquitin conjugating enzyme UBC3/CDC34. Studies suggest that CK2-dependent phosphorylation of this ubiquitin-conjugating enzyme functions by regulating beta-TrCP substrate recognition and induces its interaction with beta-TrCP, enhancing beta-catenin degradation. [provided by RefSeq, Jul 2008]

Uniprot Description

UBC3B: an E2 ubiquitin conjugating enzyme similar to UBC3/CDC34. Phosphorylation of UBC3B by CK2 induces its interaction with beta-TrCP, regulating beta-TrCP substrate recognition and enhancing beta-catenin degradation.

Protein type: Ubiquitin conjugating system; Ubiquitin ligase; EC 6.3.2.19; Ligase

Chromosomal Location of Human Ortholog: 9p13.3

Cellular Component: cytoplasm

Molecular Function: protein binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: proteasomal ubiquitin-dependent protein catabolic process; protein monoubiquitination

Research Articles on UBE2R2

Similar Products

Product Notes

The UBE2R2 ube2r2 (Catalog #AAA1277267) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccagc agcagatgac cagctcgcag aaggccctga tgctcgagct gaaatccctg caggaggaac cggtggaggg cttccggatc accctggtgg acgagtccga cctctacaac tgggaggtgg ccatcttcgg accccccaac accctctacg aaggcggcta cttcaaggcg catattaaat ttcctattga ctacccctat tcaccaccta ccttcagatt cttgaccaaa atgtggcacc ccaacattta tgagaatgga gatgtatgca tttcgattct tcatccgcct gtagatgacc cacagagtgg agaactgcct tctgaaaggt ggaatcctac tcagaatgtg aggactatcc tattaagtgt aatctcactg cttaatgagc ccaacacctt ctccccagcc aatgtcgatg cttcagttat gttcaggaaa tggagagaca gtaaaggaaa agacaaagaa tatgctgaaa ttattaggaa acaagtttca gccactaagg ccgaagcaga aaaggatgga gtgaaggtcc ccacaaccct ggcggaatac tgcatcaaaa ctaaagtgcc ttccaatgac aacagctcag atttgcttta cgacgacttg tatgatgacg acattgatga tgaagatgag gaggaggaag atgccgactg ttatgatgat gatgattctg ggaatgagga gtcgtga. It is sometimes possible for the material contained within the vial of "UBE2R2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.