Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2H cdna clone

UBE2H cDNA Clone

Gene Names
UBE2H; GID3; UBC8; UBCH; UBCH2; E2-20K
Synonyms
UBE2H; UBE2H cDNA Clone; UBE2H cdna clone
Ordering
For Research Use Only!
Sequence
atgtcatctcccagtccgggcaagaggcggatggacacggacgtggtcaagctcatcgagagtaaacatgaggttacgatcctgggaggacttaatgaatttgtagtgaagttttatggaccacaaggaacaccatatgaaggcggagtatggaaagttagagtggacctacctgataaataccctttcaaatctccatctataggattcatgaataaaattttccatcccaacattgatgaagcgtcaggaactgtgtgtctagatgtaattaatcaaacttggacagctctctatgatcttaccaatatatttgagtccttcctgcctcagttattggcctatcctaaccccatagatcctctcaatggtgacgctgcagccatgtacctccaccgaccagaagaatacaagcagaaaattaaagagtacatccagaaatacgccacggaggaggcgctgaaagaacaggaagagggtaccggggacagctcatcggagagctctatgtctgacttttccgaagatgaggcccaggatatggagttgtag
Sequence Length
552
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,174 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast), mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 H
NCBI Official Symbol
UBE2H
NCBI Official Synonym Symbols
GID3; UBC8; UBCH; UBCH2; E2-20K
NCBI Protein Information
ubiquitin-conjugating enzyme E2 H
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 H
UniProt Gene Name
UBE2H
UniProt Entry Name
UBE2H_HUMAN

NCBI Description

The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein sequence is 100% identical to the mouse homolog and 98% identical to the frog and zebrafish homologs. Three alternatively spliced transcript variants have been found for this gene and they encode distinct isoforms. [provided by RefSeq, Feb 2011]

Uniprot Description

UBE2H: Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro catalyzes 'Lys- 11'- and 'Lys-48'-linked polyubiquitination. Capable, in vitro, to ubiquitinate histone H2A. Belongs to the ubiquitin-conjugating enzyme family.

Protein type: Ubiquitin ligase; EC 6.3.2.19; Ubiquitin conjugating system; Ligase; Mitochondrial

Chromosomal Location of Human Ortholog: 7q32

Cellular Component: cytoplasm

Molecular Function: protein binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: ubiquitin-dependent protein catabolic process

Research Articles on UBE2H

Similar Products

Product Notes

The UBE2H ube2h (Catalog #AAA1269441) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcatctc ccagtccggg caagaggcgg atggacacgg acgtggtcaa gctcatcgag agtaaacatg aggttacgat cctgggagga cttaatgaat ttgtagtgaa gttttatgga ccacaaggaa caccatatga aggcggagta tggaaagtta gagtggacct acctgataaa taccctttca aatctccatc tataggattc atgaataaaa ttttccatcc caacattgat gaagcgtcag gaactgtgtg tctagatgta attaatcaaa cttggacagc tctctatgat cttaccaata tatttgagtc cttcctgcct cagttattgg cctatcctaa ccccatagat cctctcaatg gtgacgctgc agccatgtac ctccaccgac cagaagaata caagcagaaa attaaagagt acatccagaa atacgccacg gaggaggcgc tgaaagaaca ggaagagggt accggggaca gctcatcgga gagctctatg tctgactttt ccgaagatga ggcccaggat atggagttgt ag. It is sometimes possible for the material contained within the vial of "UBE2H, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.