Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBASH3A cdna clone

UBASH3A cDNA Clone

Gene Names
UBASH3A; TULA; CLIP4; STS-2; TULA-1
Synonyms
UBASH3A; UBASH3A cDNA Clone; UBASH3A cdna clone
Ordering
For Research Use Only!
Sequence
atggcagcgggggagacgcagctctacgccaaggtctccaacaagctcaagggccgcagcagcccctccctcctggagcccttcctggccatgggcttcccggtgcacaccgcgctgaaagcgttggcagccacggggaggaagacggcggaggaggccttggcctggctgcatgatcattgcaatgaccattccctagacgaccccatcccccaggagtatgcccttttcctctgtccaacggggcccctgctggaaaaacttcaagagttctggagagagagcaagcgccagtgtgcaaagaacagagctcatgaggtcttcccacacgtgacactctgtgacttcttcacgtgtgaagaccagaaggtggaatgcctgtacgaggcgctgaagagagctggagacaggctcctgggctccttccccacggccgtgcctctggctctccactcctccatcagctacctcggcttcttcgtcagtggcagccccgcagacgtcatccgggaattcgccatgaccttcgccacggaagcatctctcttagcagactgctccgtgaagccttacaccaaacagctgcatctgaccttggcccacaagttctacccccaccaccagaggacgctggagcagctggccagagccatccccctgggccacagctgccagtggaccgcagcactctactcccgagacatgcgctttgtgcactaccagaccctgagagccctattccagtacaaaccccagaacgtggatgagctgacgctaagtcctggtgactacatctttgtggaccccacgcagcaggacgaagccagcgagggctgggtgattgggatctcacagcggacgggctgccggggcttcctgccggaaaactacacggatcgagccagtgagtctgacacgtgggtgaagcacaggatgtacaccttcagtctagccacagacctgaactccagaaaggatggtgaagccagcagcagatgcagcggggaatttcttccacaaacggcaaggagtcttagcagcttacaggccttgcaggctaccattgcaaggaagagcgtgctggtggttcgccacggggagagagtggatcagatcttcgggaaggcatggctgcagcaatgctccactcctgatgggaaatactacaggccagacctgaatttcccctgcagtctgccaagacggagtcgtgggatcaaagactttgaaaacgatcccccattatcatcgtgtggcattttccagtccagaattgcaggggacgcgctactggacagtggtatcagaatcagctctgtgtttgcctccccagccctccgctgtgtgcagacggccaaactcatcctggaagaactcaaactggagaaaaaaatcaagatacgagtggaacctggaatctttgaatggacaaaatgggaagctggcaaaaccaccccaaccctcatgagcctggaagagctgaaagaggcaaatttcaacattgacactgattacaggcccgcgtttcccctgtccgccctcatgccggccgagagctaccaggagtacatggacaggtgcacggcgagcatggtgcaaatcgtcaacacctgtccgcaggacacgggtgtcatcctaattgtgagtcacggctccactctggactcctgcacgcggccactgctcgggctgccgccccgggaatgtggggattttgcccaactcgtgagaaagatcccttccctgggcatgtgcttctgtgaagaaaataaagaggaaggaaaatgggagttggtgaacccaccggtgaagaccctgacccacggggcgaacgcagtatttaactggaggaactggatctcaggcaactga
Sequence Length
1872
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,167 Da
NCBI Official Full Name
Homo sapiens ubiquitin associated and SH3 domain containing, A, mRNA
NCBI Official Synonym Full Names
ubiquitin associated and SH3 domain containing A
NCBI Official Symbol
UBASH3A
NCBI Official Synonym Symbols
TULA; CLIP4; STS-2; TULA-1
NCBI Protein Information
ubiquitin-associated and SH3 domain-containing protein A
UniProt Protein Name
Ubiquitin-associated and SH3 domain-containing protein A
UniProt Gene Name
UBASH3A
UniProt Synonym Gene Names
STS2; CLIP4; STS-2; TULA-1
UniProt Entry Name
UBS3A_HUMAN

NCBI Description

This gene encodes one of two family members belonging to the T-cell ubiquitin ligand (TULA) family. Both family members can negatively regulate T-cell signaling. This family member can facilitate growth factor withdrawal-induced apoptosis in T cells, which may occur via its interaction with AIF, an apoptosis-inducing factor. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Uniprot Description

STS2: Interferes with CBL-mediated down-regulation and degradation of receptor-type tyrosine kinases. Promotes accumulation of activated target receptors, such as T-cell receptors, EGFR and PDGFRB, on the cell surface. Exhibits negligigle protein tyrosine phosphatase activity at neutral pH. May act as a dominant-negative regulator of UBASH3B-dependent dephosphorylation. May inhibit dynamin-dependent endocytic pathways by functionally sequestering dynamin via its SH3 domain. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Protein phosphatase, tyrosine (non-receptor)

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: cytosol

Molecular Function: protein binding

Research Articles on UBASH3A

Similar Products

Product Notes

The UBASH3A ubash3a (Catalog #AAA1274191) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcgg gggagacgca gctctacgcc aaggtctcca acaagctcaa gggccgcagc agcccctccc tcctggagcc cttcctggcc atgggcttcc cggtgcacac cgcgctgaaa gcgttggcag ccacggggag gaagacggcg gaggaggcct tggcctggct gcatgatcat tgcaatgacc attccctaga cgaccccatc ccccaggagt atgccctttt cctctgtcca acggggcccc tgctggaaaa acttcaagag ttctggagag agagcaagcg ccagtgtgca aagaacagag ctcatgaggt cttcccacac gtgacactct gtgacttctt cacgtgtgaa gaccagaagg tggaatgcct gtacgaggcg ctgaagagag ctggagacag gctcctgggc tccttcccca cggccgtgcc tctggctctc cactcctcca tcagctacct cggcttcttc gtcagtggca gccccgcaga cgtcatccgg gaattcgcca tgaccttcgc cacggaagca tctctcttag cagactgctc cgtgaagcct tacaccaaac agctgcatct gaccttggcc cacaagttct acccccacca ccagaggacg ctggagcagc tggccagagc catccccctg ggccacagct gccagtggac cgcagcactc tactcccgag acatgcgctt tgtgcactac cagaccctga gagccctatt ccagtacaaa ccccagaacg tggatgagct gacgctaagt cctggtgact acatctttgt ggaccccacg cagcaggacg aagccagcga gggctgggtg attgggatct cacagcggac gggctgccgg ggcttcctgc cggaaaacta cacggatcga gccagtgagt ctgacacgtg ggtgaagcac aggatgtaca ccttcagtct agccacagac ctgaactcca gaaaggatgg tgaagccagc agcagatgca gcggggaatt tcttccacaa acggcaagga gtcttagcag cttacaggcc ttgcaggcta ccattgcaag gaagagcgtg ctggtggttc gccacgggga gagagtggat cagatcttcg ggaaggcatg gctgcagcaa tgctccactc ctgatgggaa atactacagg ccagacctga atttcccctg cagtctgcca agacggagtc gtgggatcaa agactttgaa aacgatcccc cattatcatc gtgtggcatt ttccagtcca gaattgcagg ggacgcgcta ctggacagtg gtatcagaat cagctctgtg tttgcctccc cagccctccg ctgtgtgcag acggccaaac tcatcctgga agaactcaaa ctggagaaaa aaatcaagat acgagtggaa cctggaatct ttgaatggac aaaatgggaa gctggcaaaa ccaccccaac cctcatgagc ctggaagagc tgaaagaggc aaatttcaac attgacactg attacaggcc cgcgtttccc ctgtccgccc tcatgccggc cgagagctac caggagtaca tggacaggtg cacggcgagc atggtgcaaa tcgtcaacac ctgtccgcag gacacgggtg tcatcctaat tgtgagtcac ggctccactc tggactcctg cacgcggcca ctgctcgggc tgccgccccg ggaatgtggg gattttgccc aactcgtgag aaagatccct tccctgggca tgtgcttctg tgaagaaaat aaagaggaag gaaaatggga gttggtgaac ccaccggtga agaccctgac ccacggggcg aacgcagtat ttaactggag gaactggatc tcaggcaact ga. It is sometimes possible for the material contained within the vial of "UBASH3A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.