UBA5 cdna clone
UBA5 cDNA Clone
Gene Names
UBA5; THIFP1; UBE1DC1
Synonyms
UBA5; UBA5 cDNA Clone; UBA5 cdna clone
Sequence
atggcggagtctgtggagcgcctgcagcagcgggtccaggagctggagcgggaacttgcccaggagaggagtctgcaggtcccgaggagcggcgacggagggggcggccgggtccgcatcgagaagatgagctcagaggtggtggattcgaatccctacagccgcttgatggcattgaaacgaatgggaattgtaagcgactatgagaaaatccgtacctttgccgtagcaatagtaggtgttggtggagtaggtagtgtgactgctgaaatgctgacaagatgtggcattggtaagttgctactctttgattatgacaaggtggaactagccaatatgaatagacttttcttccaacctcatcaagcaggattaagtaaagttcaagcagcagaacatactctgaggaacattaatcctgatgttctttttgaagtacacaactataatataaccacagtggaaaactttcaacatttcatggatagaataagtaatggtgggttagaagaaggaaaacctgttgatctagttcttagctgtgtggacaattttgaagctcgaatgacaataaatacagcttgtaatgaacttggacaaacatggatggaatctggggtcagtgaaaatgcagtttcagggcatatacagcttataattcctggagaatctgcttgttttgcgtgtgctccaccacttgtagttgctgcaaatattgatgaaaagactctgaaacgagaaggtgtttgtgcagccagtcttcctaccactatgggtgtggttgctgggatcttagtacaaaacgtgttaaagtttctgttaaattttggtactgttagtttttaccttggatacaatgcaatgcaggatttttttcctactatgtccatgaagccaaatcctcagtgtgatgacagaaattgcaggaagcagcaggaggaatataagaaaaaggtagcagcactgcctaaacaagaggttatacaagaagaggaagagataatccatgaagataatgaatggggtattgagctggtatctgaggtttcagaagaggaactgaaaaatttttcaggtccagttccagacttacctgaaggaattacagtggcatacacaattccaaaaaagcaagaagattctgtcactgagttaacagtggaagattctggtgaaagcttggaagacctcatggccaaaatgaagaatatgtag
Sequence Length
1215
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,537 Da
NCBI Official Full Name
Homo sapiens ubiquitin-like modifier activating enzyme 5, mRNA
NCBI Official Synonym Full Names
ubiquitin like modifier activating enzyme 5
NCBI Official Symbol
UBA5
NCBI Official Synonym Symbols
THIFP1; UBE1DC1
NCBI Protein Information
ubiquitin-like modifier-activating enzyme 5
UniProt Protein Name
Ubiquitin-like modifier-activating enzyme 5
UniProt Gene Name
UBA5
UniProt Synonym Gene Names
UBE1DC1; Ubiquitin-activating enzyme 5
UniProt Entry Name
UBA5_HUMAN
NCBI Description
This gene encodes a member of the E1-like ubiquitin-activating enzyme family. This protein activates ubiquitin-fold modifier 1, a ubiquitin-like post-translational modifier protein, via the formation of a high-energy thioester bond. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been identified on chromosome 1. [provided by RefSeq, Feb 2016]
Uniprot Description
UBE1DC1: E1-like enzyme which activates UFM1 and SUMO2. Belongs to the ubiquitin-activating E1 family. UBA5 subfamily. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Ubiquitin conjugating system; Autophagy
Chromosomal Location of Human Ortholog: 3q22.1
Cellular Component: cytoplasm; cytosol; intracellular membrane-bound organelle
Molecular Function: protein binding
Biological Process: regulation of estrogen receptor signaling pathway
Research Articles on UBA5
Similar Products
Product Notes
The UBA5 uba5 (Catalog #AAA1265915) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagt ctgtggagcg cctgcagcag cgggtccagg agctggagcg ggaacttgcc caggagagga gtctgcaggt cccgaggagc ggcgacggag ggggcggccg ggtccgcatc gagaagatga gctcagaggt ggtggattcg aatccctaca gccgcttgat ggcattgaaa cgaatgggaa ttgtaagcga ctatgagaaa atccgtacct ttgccgtagc aatagtaggt gttggtggag taggtagtgt gactgctgaa atgctgacaa gatgtggcat tggtaagttg ctactctttg attatgacaa ggtggaacta gccaatatga atagactttt cttccaacct catcaagcag gattaagtaa agttcaagca gcagaacata ctctgaggaa cattaatcct gatgttcttt ttgaagtaca caactataat ataaccacag tggaaaactt tcaacatttc atggatagaa taagtaatgg tgggttagaa gaaggaaaac ctgttgatct agttcttagc tgtgtggaca attttgaagc tcgaatgaca ataaatacag cttgtaatga acttggacaa acatggatgg aatctggggt cagtgaaaat gcagtttcag ggcatataca gcttataatt cctggagaat ctgcttgttt tgcgtgtgct ccaccacttg tagttgctgc aaatattgat gaaaagactc tgaaacgaga aggtgtttgt gcagccagtc ttcctaccac tatgggtgtg gttgctggga tcttagtaca aaacgtgtta aagtttctgt taaattttgg tactgttagt ttttaccttg gatacaatgc aatgcaggat ttttttccta ctatgtccat gaagccaaat cctcagtgtg atgacagaaa ttgcaggaag cagcaggagg aatataagaa aaaggtagca gcactgccta aacaagaggt tatacaagaa gaggaagaga taatccatga agataatgaa tggggtattg agctggtatc tgaggtttca gaagaggaac tgaaaaattt ttcaggtcca gttccagact tacctgaagg aattacagtg gcatacacaa ttccaaaaaa gcaagaagat tctgtcactg agttaacagt ggaagattct ggtgaaagct tggaagacct catggccaaa atgaagaata tgtag. It is sometimes possible for the material contained within the vial of "UBA5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
