Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UAP1 cdna clone

UAP1 cDNA Clone

Gene Names
UAP1; AGX; AGX1; AGX2; SPAG2
Synonyms
UAP1; UAP1 cDNA Clone; UAP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacattaatgacctcaaactcacgttgtccaaagctgggcaagagcacctactacgtttctggaatgagcttgaagaagcccaacaggtagaactttatgcagagctccaggccatgaactttgaggagctgaacttctttttccaaaaggccattgaaggttttaaccagtcttcttaccaaaagaatgtggatgcacgaatggaacctgtgcctcgagaggtattaggcagtgctacaagggatcaagatcagctccaggcctgggaaagtgaaggacttttccagatttctcagaataaagtagcagttcttcttctagctggtgggcaggggacaagactcggcgttgcatatcctaaggggatgtatgatgttggtttgccatcccgtaagacactttttcagattcaagcagagcgtatcctgaagctacagcaggttgctgaaaaatattatggcaacaaatgcattattccatggtatataatgaccagtggcagaacaatggaatctacaaaggagttcttcaccaagcacaagtactttggtttaaaaaaagagaatgtaatcttttttcagcaaggaatgctccccgccatgagttttgatgggaaaattattttggaagagaagaacaaagtttctatggctccagatgggaatggtggtctttatcgggcacttgcagcccagaatattgtggaggatatggagcaaagaggcatttggagcattcatgtctattgtgttgacaacatattagtaaaagtggcagacccacggttcattggattttgcattcagaaaggagcagactgtggagcaaaggtggtagagaaaacgaaccctacagaaccagttggagtggtttgccgagtggatggagtttaccaggtggtagaatatagtgagatttccctggcaacagctcaaaaacgaagctcagacggacgactgctgttcaatgcggggaacattgccaaccatttcttcactgtaccatttctgagagatgttgtcaatgtttatgaacctcagttgcagcaccatgtggctcaaaagaagattccttatgtggatacccaaggacagttaattaagccagacaaacccaatggaataaagatggaaaaatttgtctttgacatcttccagtttgcaaagaagtttgtggtatatgaagtattgcgagaagatgagttttccccactaaagaatgctgatagtcagaatgggaaagacaaccctactactgcaaggcatgctttgatgtcccttcatcattgctgggtcctcaatgcagggggccatttcatagatgaaaatggctctcgccttccagcaattccccgcttgaaggatgccaatgatgtaccaatccaatgtgaaatctctcctcttatctcctatgctggagaaggattagaaagttatgtggcagataaagaattccatgcacctctaatcatcgatgagaatggagttcatgagctggtgaaaaatggtatttga
Sequence Length
1518
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,682 Da
NCBI Official Full Name
Homo sapiens UDP-N-acteylglucosamine pyrophosphorylase 1, mRNA
NCBI Official Synonym Full Names
UDP-N-acetylglucosamine pyrophosphorylase 1
NCBI Official Symbol
UAP1
NCBI Official Synonym Symbols
AGX; AGX1; AGX2; SPAG2
NCBI Protein Information
UDP-N-acetylhexosamine pyrophosphorylase
UniProt Protein Name
UDP-N-acetylhexosamine pyrophosphorylase
UniProt Gene Name
UAP1
UniProt Synonym Gene Names
SPAG2; AGX
UniProt Entry Name
UAP1_HUMAN

Uniprot Description

UAP1: Converts UDP and GlcNAc-1-P into UDP-GlcNAc, and UDP and GalNAc-1-P into UDP-GalNAc. Isoform AGX1 has 2 to 3 times higher activity towards GalNAc-1-P, while isoform AGX2 has 8 times more activity towards GlcNAc-1-P. Belongs to the UDPGP type 1 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.7.7.83; Carbohydrate Metabolism - amino sugar and nucleotide sugar; Transferase; EC 2.7.7.23; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 1q23.3

Cellular Component: cytoplasm; cytosol; nucleoplasm; plasma membrane

Molecular Function: identical protein binding; UDP-N-acetylglucosamine diphosphorylase activity

Biological Process: UDP-N-acetylglucosamine biosynthetic process

Research Articles on UAP1

Similar Products

Product Notes

The UAP1 uap1 (Catalog #AAA1266021) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacatta atgacctcaa actcacgttg tccaaagctg ggcaagagca cctactacgt ttctggaatg agcttgaaga agcccaacag gtagaacttt atgcagagct ccaggccatg aactttgagg agctgaactt ctttttccaa aaggccattg aaggttttaa ccagtcttct taccaaaaga atgtggatgc acgaatggaa cctgtgcctc gagaggtatt aggcagtgct acaagggatc aagatcagct ccaggcctgg gaaagtgaag gacttttcca gatttctcag aataaagtag cagttcttct tctagctggt gggcagggga caagactcgg cgttgcatat cctaagggga tgtatgatgt tggtttgcca tcccgtaaga cactttttca gattcaagca gagcgtatcc tgaagctaca gcaggttgct gaaaaatatt atggcaacaa atgcattatt ccatggtata taatgaccag tggcagaaca atggaatcta caaaggagtt cttcaccaag cacaagtact ttggtttaaa aaaagagaat gtaatctttt ttcagcaagg aatgctcccc gccatgagtt ttgatgggaa aattattttg gaagagaaga acaaagtttc tatggctcca gatgggaatg gtggtcttta tcgggcactt gcagcccaga atattgtgga ggatatggag caaagaggca tttggagcat tcatgtctat tgtgttgaca acatattagt aaaagtggca gacccacggt tcattggatt ttgcattcag aaaggagcag actgtggagc aaaggtggta gagaaaacga accctacaga accagttgga gtggtttgcc gagtggatgg agtttaccag gtggtagaat atagtgagat ttccctggca acagctcaaa aacgaagctc agacggacga ctgctgttca atgcggggaa cattgccaac catttcttca ctgtaccatt tctgagagat gttgtcaatg tttatgaacc tcagttgcag caccatgtgg ctcaaaagaa gattccttat gtggataccc aaggacagtt aattaagcca gacaaaccca atggaataaa gatggaaaaa tttgtctttg acatcttcca gtttgcaaag aagtttgtgg tatatgaagt attgcgagaa gatgagtttt ccccactaaa gaatgctgat agtcagaatg ggaaagacaa ccctactact gcaaggcatg ctttgatgtc ccttcatcat tgctgggtcc tcaatgcagg gggccatttc atagatgaaa atggctctcg ccttccagca attccccgct tgaaggatgc caatgatgta ccaatccaat gtgaaatctc tcctcttatc tcctatgctg gagaaggatt agaaagttat gtggcagata aagaattcca tgcacctcta atcatcgatg agaatggagt tcatgagctg gtgaaaaatg gtatttga. It is sometimes possible for the material contained within the vial of "UAP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.