Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

U2AF2 cdna clone

U2AF2 cDNA Clone

Gene Names
U2AF2; U2AF65
Synonyms
U2AF2; U2AF2 cDNA Clone; U2AF2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggacttcgacgagttcgagcggcagctcaacgagaataaacaagagcgggacaaggagaaccggcatcggaagcgcagccacagccgctctcggagccgggaccgcaaacgccggagccggagccgcgaccggcgcaaccgggaccagcggagcgcctcccgggacaggcgacgacgcagcaaacctttgaccagaggcgctaaagaggagcacggtggactgattcgttccccccgccacgagaagaagaagaaggtccgtaaatactgggacgtgccacccccaggctttgagcacatcaccccaatgcagtacaaggccatgcaagctgcgggtcagattccagccactgctcttctccccaccatgacccctgacggtctggctgtgaccccaacgccggtgcccgtggtcgggagccagatgaccagacaagcccggcgcctctacgtgggcaacatcccctttggcatcactgaggaggccatgatggatttcttcaacgcccagatgcgcctgggggggctgacccaggcccctggcaacccagtgttggctgtgcagattaaccaggacaagaattttgcctttttggagttccgctcagtggacgagactacccaggctatggcctttgatggcatcatcttccagggccagtcactaaagatccgcaggcctcacgactaccagccgcttcctggcatgtcagagaacccctccgtctatgtgcctggggttgtgtccactgtggtccccgactctgcccacaagctgttcatcgggggcttacccaactacctgaacgatgaccaggtcaaagagctgctgacatcctttgggcccctcaaggccttcaacctggtcaaggacagtgccacggggctctccaagggctacgccttctgtgagtacgtggacatcaacgtcacggatcaggccattgcggggctgaacggcatgcagctgggggataagaagctgctggtccagagggcgagtgtgggagccaagaatgccacgctgagcaccatcaatcagacgcctgtgaccctgcaagtgccgggcttgatgagctcccaggtgcagatgggcggccacccgactgaggtcctgtgcctcatgaacatggtgctgcctgaggagctgctggacgacgaggagtatgaggagatcgtggaggatgtgcgggacgagtgcagcaagtacgggcttgtcaagtccatcgagatcccccggcctgtggacggcgtcgaggtgcccggctgcggaaagatctttgtggagttcacctctgtgtttgactgccagaaagccatgcagggcctgacgggccgcaagttcgccaacagagtggttgtcacaaaatactgtgaccccgactcttatcaccgccgggacttctggtag
Sequence Length
1416
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,121 Da
NCBI Official Full Name
Homo sapiens U2 small nuclear RNA auxiliary factor 2, mRNA
NCBI Official Synonym Full Names
U2 small nuclear RNA auxiliary factor 2
NCBI Official Symbol
U2AF2
NCBI Official Synonym Symbols
U2AF65
NCBI Protein Information
splicing factor U2AF 65 kDa subunit
UniProt Protein Name
Splicing factor U2AF 65 kDa subunit
Protein Family
UniProt Gene Name
U2AF2
UniProt Synonym Gene Names
U2AF65; hU2AF(65); hU2AF65
UniProt Entry Name
U2AF2_HUMAN

NCBI Description

U2 auxiliary factor (U2AF), comprised of a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the U2AF large subunit which contains a sequence-specific RNA-binding region with 3 RNA recognition motifs and an Arg/Ser-rich domain necessary for splicing. The large subunit binds to the polypyrimidine tract of introns early during spliceosome assembly. Multiple transcript variants have been detected for this gene, but the full-length natures of only two have been determined to date. [provided by RefSeq, Jul 2008]

Uniprot Description

U2AF2: Necessary for the splicing of pre-mRNA. Induces cardiac troponin-T (TNNT2) pre-mRNA exon inclusion in muscle. Regulates the TNNT2 exon 5 inclusion through competition with MBNL1. Binds preferentially to a single-stranded structure within the polypyrimidine tract of TNNT2 intron 4 during spliceosome assembly. Required for the export of mRNA out of the nucleus, even if the mRNA is encoded by an intron-less gene. Represses the splicing of MAPT/Tau exon 10. Belongs to the splicing factor SR family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Spliceosome; RNA splicing; RNA-binding

Chromosomal Location of Human Ortholog: 19q13.42

Cellular Component: nuclear speck; nucleoplasm; nucleus; spliceosome

Molecular Function: enzyme binding; poly-pyrimidine tract binding; pre-mRNA 3'-splice site binding; protein binding

Biological Process: mRNA 3'-end processing; mRNA export from nucleus; mRNA processing; negative regulation of nuclear mRNA splicing, via spliceosome; nuclear mRNA splicing, via spliceosome; positive regulation of RNA splicing; RNA export from nucleus; termination of RNA polymerase II transcription

Research Articles on U2AF2

Similar Products

Product Notes

The U2AF2 u2af2 (Catalog #AAA1273243) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggact tcgacgagtt cgagcggcag ctcaacgaga ataaacaaga gcgggacaag gagaaccggc atcggaagcg cagccacagc cgctctcgga gccgggaccg caaacgccgg agccggagcc gcgaccggcg caaccgggac cagcggagcg cctcccggga caggcgacga cgcagcaaac ctttgaccag aggcgctaaa gaggagcacg gtggactgat tcgttccccc cgccacgaga agaagaagaa ggtccgtaaa tactgggacg tgccaccccc aggctttgag cacatcaccc caatgcagta caaggccatg caagctgcgg gtcagattcc agccactgct cttctcccca ccatgacccc tgacggtctg gctgtgaccc caacgccggt gcccgtggtc gggagccaga tgaccagaca agcccggcgc ctctacgtgg gcaacatccc ctttggcatc actgaggagg ccatgatgga tttcttcaac gcccagatgc gcctgggggg gctgacccag gcccctggca acccagtgtt ggctgtgcag attaaccagg acaagaattt tgcctttttg gagttccgct cagtggacga gactacccag gctatggcct ttgatggcat catcttccag ggccagtcac taaagatccg caggcctcac gactaccagc cgcttcctgg catgtcagag aacccctccg tctatgtgcc tggggttgtg tccactgtgg tccccgactc tgcccacaag ctgttcatcg ggggcttacc caactacctg aacgatgacc aggtcaaaga gctgctgaca tcctttgggc ccctcaaggc cttcaacctg gtcaaggaca gtgccacggg gctctccaag ggctacgcct tctgtgagta cgtggacatc aacgtcacgg atcaggccat tgcggggctg aacggcatgc agctggggga taagaagctg ctggtccaga gggcgagtgt gggagccaag aatgccacgc tgagcaccat caatcagacg cctgtgaccc tgcaagtgcc gggcttgatg agctcccagg tgcagatggg cggccacccg actgaggtcc tgtgcctcat gaacatggtg ctgcctgagg agctgctgga cgacgaggag tatgaggaga tcgtggagga tgtgcgggac gagtgcagca agtacgggct tgtcaagtcc atcgagatcc cccggcctgt ggacggcgtc gaggtgcccg gctgcggaaa gatctttgtg gagttcacct ctgtgtttga ctgccagaaa gccatgcagg gcctgacggg ccgcaagttc gccaacagag tggttgtcac aaaatactgt gaccccgact cttatcaccg ccgggacttc tggtag. It is sometimes possible for the material contained within the vial of "U2AF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.