Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TXNRD2 cdna clone

TXNRD2 cDNA Clone

Gene Names
TXNRD2; TR; TR3; SELZ; TRXR2; TR-BETA
Synonyms
TXNRD2; TXNRD2 cDNA Clone; TXNRD2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaccaggcggcactgctgggaggcctgatccaagatgcccccaactatggctgggaggtggcccagcccgtgccgcatgactggaggaagatggcagaagctgttcaaaatcacgtgaaatccttgaactggggccaccgtgtccagcttcaggacagaaaagtcaagtactttaacatcaaagccagctttgttgacgagcacacggtttgcggcgttgccaaaggtgggaaagagattctgctgtcagccgatcacatcatcattgctactggagggcggccgagataccccacgcacatcgaaggtgccttggaatatggaatcacaagtgatgacatcttctggctgaaggaatcccctggaaaaacgttggtggtcggggccagctatgtggccctggagtgtgctggcttcctcaccgggattgggctggacaccaccatcatgatgcgcagcatccccctccgcggcttcgaccagcaaatgtcctccatggtcatagagcacatggcatctcatggcacccggttcctgaggggctgtgccccctcgcgggtcaggaggctccctgatggccagctgcaggtcacctgggaggacagcaccaccggcaaggaggacacgggcacctttgacaccgtcctgtgggccataggtcgagtcccagacaccagaagtctgaatttggagaaggctggggtagatactagccccgacactcagaagatcctggtggactcccgggaagccacctctgtgccccacatctacgccattggtgacgtggtggaggggcggcctgagctgacacccatagcgatcatggccgggaggctcctggtgcagcggctcttcggcgggtcctcagatctgatggactacgacaatgttcccacgaccgtcttcaccccgctggagtatggctgtgtggggctgtccgaggaggaggcagtggctcgccacgggcaggagcatgttgaggtctatcacgcccattataaaccactggagttcacggtggctggacgagatgcatcccagtgttatgtaaagatggtgtgcctgagggagcccccacagctggtgctgggcctgcatttccttggccccaacgcaggcgaagttactcaaggatttgctctggggatcaagtgtggggcttcctatgcgcaggtgatgcggaccgtgggtatccatcccacatgctctgaggaggtagtcaagctgcgcatctccaagcgctcaggcctggaccccacggtgacaggctgctgagggtaa
Sequence Length
1287
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,291 Da
NCBI Official Full Name
Homo sapiens thioredoxin reductase 2, mRNA
NCBI Official Synonym Full Names
thioredoxin reductase 2
NCBI Official Symbol
TXNRD2
NCBI Official Synonym Symbols
TR; TR3; SELZ; TRXR2; TR-BETA
NCBI Protein Information
thioredoxin reductase 2, mitochondrial
UniProt Protein Name
Thioredoxin reductase 2, mitochondrial
UniProt Gene Name
TXNRD2
UniProt Synonym Gene Names
KIAA1652; TRXR2; SelZ
UniProt Entry Name
TRXR2_HUMAN

NCBI Description

This gene encodes a member of the class I pyridine nucleotide-disulfide oxidoreductase family. The encoded protein is a selenocysteine-containing flavoenzyme that maintains thioredoxins in a reduced state, thereby playing a key role in regulating the cellular redox environment. Mammals have three related thioredoxin reductases. This gene encodes a mitochondrial form important for scavenging of reactive oxygen species in mitochondria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2013]

Uniprot Description

TXNRD2: Maintains thioredoxin in a reduced state. Implicated in the defenses against oxidative stress. May play a role in redox- regulated cell signaling. Belongs to the class-I pyridine nucleotide-disulfide oxidoreductase family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator; EC 1.8.1.9; Oxidoreductase; Nucleotide Metabolism - pyrimidine; Mitochondrial

Chromosomal Location of Human Ortholog: 22q11.21

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: protein binding; thioredoxin-disulfide reductase activity

Biological Process: response to oxygen radical; response to reactive oxygen species

Research Articles on TXNRD2

Similar Products

Product Notes

The TXNRD2 txnrd2 (Catalog #AAA1274593) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaccagg cggcactgct gggaggcctg atccaagatg cccccaacta tggctgggag gtggcccagc ccgtgccgca tgactggagg aagatggcag aagctgttca aaatcacgtg aaatccttga actggggcca ccgtgtccag cttcaggaca gaaaagtcaa gtactttaac atcaaagcca gctttgttga cgagcacacg gtttgcggcg ttgccaaagg tgggaaagag attctgctgt cagccgatca catcatcatt gctactggag ggcggccgag ataccccacg cacatcgaag gtgccttgga atatggaatc acaagtgatg acatcttctg gctgaaggaa tcccctggaa aaacgttggt ggtcggggcc agctatgtgg ccctggagtg tgctggcttc ctcaccggga ttgggctgga caccaccatc atgatgcgca gcatccccct ccgcggcttc gaccagcaaa tgtcctccat ggtcatagag cacatggcat ctcatggcac ccggttcctg aggggctgtg ccccctcgcg ggtcaggagg ctccctgatg gccagctgca ggtcacctgg gaggacagca ccaccggcaa ggaggacacg ggcacctttg acaccgtcct gtgggccata ggtcgagtcc cagacaccag aagtctgaat ttggagaagg ctggggtaga tactagcccc gacactcaga agatcctggt ggactcccgg gaagccacct ctgtgcccca catctacgcc attggtgacg tggtggaggg gcggcctgag ctgacaccca tagcgatcat ggccgggagg ctcctggtgc agcggctctt cggcgggtcc tcagatctga tggactacga caatgttccc acgaccgtct tcaccccgct ggagtatggc tgtgtggggc tgtccgagga ggaggcagtg gctcgccacg ggcaggagca tgttgaggtc tatcacgccc attataaacc actggagttc acggtggctg gacgagatgc atcccagtgt tatgtaaaga tggtgtgcct gagggagccc ccacagctgg tgctgggcct gcatttcctt ggccccaacg caggcgaagt tactcaagga tttgctctgg ggatcaagtg tggggcttcc tatgcgcagg tgatgcggac cgtgggtatc catcccacat gctctgagga ggtagtcaag ctgcgcatct ccaagcgctc aggcctggac cccacggtga caggctgctg agggtaa. It is sometimes possible for the material contained within the vial of "TXNRD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.