Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TXNDC9 cdna clone

TXNDC9 cDNA Clone

Gene Names
TXNDC9; APACD; PHLP3
Synonyms
TXNDC9; TXNDC9 cDNA Clone; TXNDC9 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagctgatgcatctgttgacatgttttccaaagtcctggagcatcagctgcttcagactaccaaactggtggaagaacatttggattctgaaattcaaaaactggatcagatggatgaggatgaattggaacgccttaaagaaaagagactccaggcactaaggaaagctcaacagcagaaacaagaatggctttctaaaggacatggggaatacagagaaatccctagtgaaagagacttttttcaagaagtcaaggagagtgaaaatgtggtttgccatttctacagagactccacattcaggtgtaaaatactagacagacatctggcaatattgtccaagaaacacctcgagaccaaatttttgaagctgaatgtggaaaaagcacctttcctttgtgagagactgcatatcaaagtcattcccacactagcactgctaaaagatgggaaaacacaagattatgttgttgggtttactgacctaggaaatacagatgacttcaccacagaaactttagaatggaggctcggttcttctgacattcttaattacaggtaa
Sequence Length
567
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,199 Da
NCBI Official Full Name
Homo sapiens thioredoxin domain containing 9, mRNA
NCBI Official Synonym Full Names
thioredoxin domain containing 9
NCBI Official Symbol
TXNDC9
NCBI Official Synonym Symbols
APACD; PHLP3
NCBI Protein Information
thioredoxin domain-containing protein 9
UniProt Protein Name
Thioredoxin domain-containing protein 9
UniProt Gene Name
TXNDC9
UniProt Synonym Gene Names
APACD
UniProt Entry Name
TXND9_HUMAN

NCBI Description

The protein encoded by this gene is a member of the thioredoxin family. The exact function of this protein is not known but it is associated with cell differentiation. [provided by RefSeq, Jul 2008]

Uniprot Description

TXNDC9: Significantly diminishes the chaperonin TCP1 complex ATPase activity, thus negatively impacts protein folding, including that of actin or tubulin.

Chromosomal Location of Human Ortholog: 2q11.2

Cellular Component: cell-cell adherens junction; cytoplasm

Molecular Function: protein binding; queuine tRNA-ribosyltransferase activity

Biological Process: queuosine biosynthetic process

Research Articles on TXNDC9

Similar Products

Product Notes

The TXNDC9 txndc9 (Catalog #AAA1267637) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagctg atgcatctgt tgacatgttt tccaaagtcc tggagcatca gctgcttcag actaccaaac tggtggaaga acatttggat tctgaaattc aaaaactgga tcagatggat gaggatgaat tggaacgcct taaagaaaag agactccagg cactaaggaa agctcaacag cagaaacaag aatggctttc taaaggacat ggggaataca gagaaatccc tagtgaaaga gacttttttc aagaagtcaa ggagagtgaa aatgtggttt gccatttcta cagagactcc acattcaggt gtaaaatact agacagacat ctggcaatat tgtccaagaa acacctcgag accaaatttt tgaagctgaa tgtggaaaaa gcacctttcc tttgtgagag actgcatatc aaagtcattc ccacactagc actgctaaaa gatgggaaaa cacaagatta tgttgttggg tttactgacc taggaaatac agatgacttc accacagaaa ctttagaatg gaggctcggt tcttctgaca ttcttaatta caggtaa. It is sometimes possible for the material contained within the vial of "TXNDC9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.