Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TWIST2 cdna clone

TWIST2 cDNA Clone

Gene Names
TWIST2; AMS; FFDD3; BBRSAY; DERMO1; SETLSS; bHLHa39
Synonyms
TWIST2; TWIST2 cDNA Clone; TWIST2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggagggctccagctcgcccgtgtcccccgtggacagcctgggcaccagcgaggaggagctcgagaggcagcccaagcgcttcggccggaagcggcgctacagcaagaagtcgagcgaagatggcagcccgaccccgggcaagcgcggcaagaagggcagccccagcgcgcagtccttcgaggagctgcagagccagcgcatcctggccaacgtgcgcgagcgccagcgcacccagtcgctcaacgaggccttcgcggcgctgcgcaagatcatccccacgctgccctctgacaagctgagcaagatccagacgctcaagctggccgccaggtacatagacttcctctaccaggtcctgcagagcgacgagatggacaataagatgaccagctgcagctacgtggcccacgagcgcctcagctacgccttctccgtgtggcgcatggagggcgcgtggtccatgtccgcctcccactag
Sequence Length
483
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,124 Da
NCBI Official Full Name
Homo sapiens twist homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
twist family bHLH transcription factor 2
NCBI Official Symbol
TWIST2
NCBI Official Synonym Symbols
AMS; FFDD3; BBRSAY; DERMO1; SETLSS; bHLHa39
NCBI Protein Information
twist-related protein 2
UniProt Protein Name
Twist-related protein 2
Protein Family
UniProt Gene Name
TWIST2
UniProt Synonym Gene Names
BHLHA39; DERMO1; bHLHa39; Dermo-1
UniProt Entry Name
TWST2_HUMAN

NCBI Description

The protein encoded by this gene is a basic helix-loop-helix type transcription factor and shares similarity with Twist. This protein may inhibit osteoblast maturation and maintain cells in a preosteoblast phenotype during osteoblast development. This gene may be upregulated in certain cancers. Mutations in this gene cause focal facial dermal dysplasia 3, Setleis type. Two transcript variants encoding the same protein have been found. [provided by RefSeq, Apr 2014]

Uniprot Description

TWIST2: Binds to the E-box consensus sequence 5'-CANNTG-3' as a heterodimer and inhibits transcriptional activation by MYOD1, MYOG, MEF2A and MEF2C. Also represses expression of proinflammatory cytokines such as TNFA and IL1B. Involved in postnatal glycogen storage and energy metabolism. Inhibits the premature or ectopic differentiation of preosteoblast cells during osteogenesis, possibly by changing the internal signal transduction response of osteoblasts to external growth factors. Defects in TWIST2 are the cause of Setleis syndrome (SETLEISS). A focal facial dermal dysplasia characterized by distinctive bitemporal scar-like depressions resembling forceps marks, and additional facial features, including a coarse and leonine appearance, absent eyelashes on both lids or multiple rows on the upper lids, absent Meibomian glands, slanted eyebrows, chin clefting, and hypo- or hyperpigmentation of the skin. Histologically, the bitemporal lesion is an ectodermal dysplasia with near absence of subcutaneous fat, suggesting insufficient migration of neural crest cells into the frontonasal process and the first branchial arch.

Chromosomal Location of Human Ortholog: 2q37.3

Cellular Component: cytoplasm; nucleus

Molecular Function: protein binding

Biological Process: negative regulation of osteoblast differentiation; negative regulation of transcription, DNA-dependent

Disease: Ablepharon-macrostomia Syndrome; Barber-say Syndrome; Focal Facial Dermal Dysplasia 3, Setleis Type

Research Articles on TWIST2

Similar Products

Product Notes

The TWIST2 twist2 (Catalog #AAA1276195) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagg gctccagctc gcccgtgtcc cccgtggaca gcctgggcac cagcgaggag gagctcgaga ggcagcccaa gcgcttcggc cggaagcggc gctacagcaa gaagtcgagc gaagatggca gcccgacccc gggcaagcgc ggcaagaagg gcagccccag cgcgcagtcc ttcgaggagc tgcagagcca gcgcatcctg gccaacgtgc gcgagcgcca gcgcacccag tcgctcaacg aggccttcgc ggcgctgcgc aagatcatcc ccacgctgcc ctctgacaag ctgagcaaga tccagacgct caagctggcc gccaggtaca tagacttcct ctaccaggtc ctgcagagcg acgagatgga caataagatg accagctgca gctacgtggc ccacgagcgc ctcagctacg ccttctccgt gtggcgcatg gagggcgcgt ggtccatgtc cgcctcccac tag. It is sometimes possible for the material contained within the vial of "TWIST2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.