Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TUFM cdna clone

TUFM cDNA Clone

Gene Names
TUFM; P43; EFTU; COXPD4; EF-TuMT
Synonyms
TUFM; TUFM cDNA Clone; TUFM cdna clone
Ordering
For Research Use Only!
Sequence
atgaccacaatggcggccgccaccctgctgcgcgcgacgccccacttcagcggtctcgccgccggccggaccttcctgctgcagggtctgttgcggctgctgaaagccccggcattgcctctcttgtgccgcggcctggccgtggaggccaagaagacttacgtgcgcgacaagccacatgtgaatgtgggtaccatcggccatgtggaccacgggaagaccacgctgactgcagccatcacgaagattctagctgagggaggtggggctaagttcaagaagtacgaggagattgacaatgccccggaggagcgagctcggggtatcaccatcaatgcggctcatgtggagtatagcactgccgcccgccactacgcccacacagactgcccgggtcatgcagattatgttaagaatatgatcacaggcactgcacccctcgacggctgcatcctggtggtagcagccaatgacggccccatgccccagacccgagagcacttattactggccagacagattggggtggagcatgtggtggtgtatgtgaacaaggctgacgctgtccaggactctgagatggtggaactggtggaactggagatccgggagctgctcaccgagtttggctataaaggggaggagaccccagtcatcgtaggctctgctctctgtgcccttgagggtcgggaccctgagttaggcctgaagtctgtgcagaagctactggatgctgtggacacttacatcccagtgcccgcccgggacctggagaagcctttcctgctgcctgtggaggcggtgtactccgtccctggccgtggcaccgtggtgacaggtacactagagcgtggcattttaaagaagggagacgagtgtgagctcctaggacatagcaagaacatccgcactgtggtgacaggcattgagatgttccacaagagcctggagagggccgaggccggagataacctcggggccctggtccgaggcttgaagcgggaggacttgcggcggggcctggtcatggtcaagccaggttccatcaagccccaccagaaggtggaggcccaggtttacatcctcagcaaggaggaaggtggccgccacaagccctttgtgtcccacttcatgcctgtcatgttctccctgacttgggacatggcctgtcggattatcctgcccccagagaaggagcttgccatgcccggggaggacctgaagttcaacctaatcttgcggcagccaatgatcttagagaaaggccagcgtttcaccctgcgagatggcaaccggactattggcaccggtctagtcaccaacacgctggccatgactgaggaggagaagaatatcaaatggggttga
Sequence Length
1368
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,542 Da
NCBI Official Full Name
Homo sapiens Tu translation elongation factor, mitochondrial, mRNA
NCBI Official Synonym Full Names
Tu translation elongation factor, mitochondrial
NCBI Official Symbol
TUFM
NCBI Official Synonym Symbols
P43; EFTU; COXPD4; EF-TuMT
NCBI Protein Information
elongation factor Tu, mitochondrial
UniProt Protein Name
Elongation factor Tu, mitochondrial
UniProt Gene Name
TUFM
UniProt Synonym Gene Names
EF-Tu
UniProt Entry Name
EFTU_HUMAN

NCBI Description

This gene encodes a protein which participates in protein translation in mitochondria. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency resulting in lactic acidosis and fatal encephalopathy. A pseudogene has been identified on chromosome 17. [provided by RefSeq, Jul 2008]

Uniprot Description

EFTU: This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis. Defects in TUFM are the cause of combined oxidative phosphorylation deficiency type 4 (COXPD4). COXPD4 is characterized by neonatal lactic acidosis, rapidly progressive encephalopathy, severely decreased mitochondrial protein synthesis, and combined deficiency of mtDNA-related mitochondrial respiratory chain complexes. Belongs to the GTP-binding elongation factor family. EF-Tu/EF-1A subfamily.

Protein type: Translation elongation; Translation; Mitochondrial; RNA-binding

Chromosomal Location of Human Ortholog: 16p11.2

Cellular Component: membrane; mitochondrion

Molecular Function: GTPase activity; protein binding; translation elongation factor activity

Biological Process: translational elongation

Disease: Combined Oxidative Phosphorylation Deficiency 4

Research Articles on TUFM

Similar Products

Product Notes

The TUFM tufm (Catalog #AAA1267293) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccacaa tggcggccgc caccctgctg cgcgcgacgc cccacttcag cggtctcgcc gccggccgga ccttcctgct gcagggtctg ttgcggctgc tgaaagcccc ggcattgcct ctcttgtgcc gcggcctggc cgtggaggcc aagaagactt acgtgcgcga caagccacat gtgaatgtgg gtaccatcgg ccatgtggac cacgggaaga ccacgctgac tgcagccatc acgaagattc tagctgaggg aggtggggct aagttcaaga agtacgagga gattgacaat gccccggagg agcgagctcg gggtatcacc atcaatgcgg ctcatgtgga gtatagcact gccgcccgcc actacgccca cacagactgc ccgggtcatg cagattatgt taagaatatg atcacaggca ctgcacccct cgacggctgc atcctggtgg tagcagccaa tgacggcccc atgccccaga cccgagagca cttattactg gccagacaga ttggggtgga gcatgtggtg gtgtatgtga acaaggctga cgctgtccag gactctgaga tggtggaact ggtggaactg gagatccggg agctgctcac cgagtttggc tataaagggg aggagacccc agtcatcgta ggctctgctc tctgtgccct tgagggtcgg gaccctgagt taggcctgaa gtctgtgcag aagctactgg atgctgtgga cacttacatc ccagtgcccg cccgggacct ggagaagcct ttcctgctgc ctgtggaggc ggtgtactcc gtccctggcc gtggcaccgt ggtgacaggt acactagagc gtggcatttt aaagaaggga gacgagtgtg agctcctagg acatagcaag aacatccgca ctgtggtgac aggcattgag atgttccaca agagcctgga gagggccgag gccggagata acctcggggc cctggtccga ggcttgaagc gggaggactt gcggcggggc ctggtcatgg tcaagccagg ttccatcaag ccccaccaga aggtggaggc ccaggtttac atcctcagca aggaggaagg tggccgccac aagccctttg tgtcccactt catgcctgtc atgttctccc tgacttggga catggcctgt cggattatcc tgcccccaga gaaggagctt gccatgcccg gggaggacct gaagttcaac ctaatcttgc ggcagccaat gatcttagag aaaggccagc gtttcaccct gcgagatggc aaccggacta ttggcaccgg tctagtcacc aacacgctgg ccatgactga ggaggagaag aatatcaaat ggggttga. It is sometimes possible for the material contained within the vial of "TUFM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.