TTLL7 cdna clone
TTLL7 cDNA Clone
Synonyms
TTLL7; TTLL7 cDNA Clone; TTLL7 cdna clone
Sequence
atgtgtagacctggtcaacctccaggaagcgaaagtgtctgctttgaagtcctgggatttgatattttgttggatagaaaactaaagccatggcttctggagattaaccgagccccaagctttggaactgatcagaaaatagactatgatgtaaaaaggggagtgctgctaaatgcgttgaagctactaaacataaggaccagtgacaaaagaagaaacttggccaaacaaaaagctgaggctcaaaggaggctctatggtcaaaattcaattaaaaggctcttaccaggctcctcagactgggaacagcagagacaccagttggagaggcggaaagaagagttgaaagagagactcgctcaagtacgaaagcagatctcacgagaagaacatgaaaatcgacatatggggaattatagacgaatttatcctcctgaagataaagcattacttgaaaagtatgaaaatttgttagctgttgcctttcagaccttcctttcaggaagagcagcttcattccagcgagagttgaataatcctttgaaaaggatgaaggaagaagatattttggatcttctggagcaatgtgaaattgatgatgaaaagttgatgggaaaaactaccaagactcgaggaccaaagcctctgtgttctatgcctgagagtactgagataatgaaaagaccaaagtactgcagcagtgacagcagttatgatagtagcagcagctcttcagaatctgacgaaaatgaaaaagaagagtaccaaaataagaaaagagaaaagcaagttacatataatcttaaaccctccaaccactacaaattaattcaacaacccagctccataagacgttcagtcagctgccctcggtccatctctgctcaatcaccttccagtggggacacccgcccattttctgctcaacaaatgatatctgtgtcacggccaacttctgcatctcggtcacattccttaaaccgtgcttcctcctacatgaggcatctgcctcacagtaatgatgcctgctctaccaactctcaagtgagtgagtctttgcggcaactgaaaacaaaagaacaagaagatgatctaacaagtcagaccttatttgttctcaaagacatgaagatccggtttccaggaaagtcagatgcagaatcagaacttctgatagaagatatcattgataactggaagtatcataaaaccaaagtggcttcatattggctcataaaattggactctgtaaaacaacgaaaagttttggacatagtgaaaacaagtattcgtacagttcttccacgcatctggaaggtgcctgatgttgaagaagtaaatttatatcggattttcaaccgggtttttaatcgcttactctggagtcgtggccaagggctgtggaactgtttctgtgattcaggttacgtgtaa
Sequence Length
1434
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
92,222 Da
NCBI Official Full Name
Homo sapiens tubulin tyrosine ligase-like family, member 7, mRNA
NCBI Official Synonym Full Names
tubulin tyrosine ligase like 7
NCBI Official Symbol
TTLL7
NCBI Protein Information
tubulin polyglutamylase TTLL7
UniProt Protein Name
Tubulin polyglutamylase TTLL7
Protein Family
UniProt Gene Name
TTLL7
UniProt Entry Name
TTLL7_HUMAN
Uniprot Description
TTLL7: Polyglutamylase which preferentially modifies beta- tubulin. Involved in the side-chain initiation step of the polyglutamylation reaction rather than in the elongation step. Required for neurite growth. Belongs to the tubulin--tyrosine ligase family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 6.-.-.-; Ligase
Chromosomal Location of Human Ortholog: 1p31.1
Molecular Function: alpha-tubulin binding; beta-tubulin binding
Biological Process: protein polyglutamylation
Similar Products
Product Notes
The TTLL7 ttll7 (Catalog #AAA1275406) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtagac ctggtcaacc tccaggaagc gaaagtgtct gctttgaagt cctgggattt gatattttgt tggatagaaa actaaagcca tggcttctgg agattaaccg agccccaagc tttggaactg atcagaaaat agactatgat gtaaaaaggg gagtgctgct aaatgcgttg aagctactaa acataaggac cagtgacaaa agaagaaact tggccaaaca aaaagctgag gctcaaagga ggctctatgg tcaaaattca attaaaaggc tcttaccagg ctcctcagac tgggaacagc agagacacca gttggagagg cggaaagaag agttgaaaga gagactcgct caagtacgaa agcagatctc acgagaagaa catgaaaatc gacatatggg gaattataga cgaatttatc ctcctgaaga taaagcatta cttgaaaagt atgaaaattt gttagctgtt gcctttcaga ccttcctttc aggaagagca gcttcattcc agcgagagtt gaataatcct ttgaaaagga tgaaggaaga agatattttg gatcttctgg agcaatgtga aattgatgat gaaaagttga tgggaaaaac taccaagact cgaggaccaa agcctctgtg ttctatgcct gagagtactg agataatgaa aagaccaaag tactgcagca gtgacagcag ttatgatagt agcagcagct cttcagaatc tgacgaaaat gaaaaagaag agtaccaaaa taagaaaaga gaaaagcaag ttacatataa tcttaaaccc tccaaccact acaaattaat tcaacaaccc agctccataa gacgttcagt cagctgccct cggtccatct ctgctcaatc accttccagt ggggacaccc gcccattttc tgctcaacaa atgatatctg tgtcacggcc aacttctgca tctcggtcac attccttaaa ccgtgcttcc tcctacatga ggcatctgcc tcacagtaat gatgcctgct ctaccaactc tcaagtgagt gagtctttgc ggcaactgaa aacaaaagaa caagaagatg atctaacaag tcagacctta tttgttctca aagacatgaa gatccggttt ccaggaaagt cagatgcaga atcagaactt ctgatagaag atatcattga taactggaag tatcataaaa ccaaagtggc ttcatattgg ctcataaaat tggactctgt aaaacaacga aaagttttgg acatagtgaa aacaagtatt cgtacagttc ttccacgcat ctggaaggtg cctgatgttg aagaagtaaa tttatatcgg attttcaacc gggtttttaa tcgcttactc tggagtcgtg gccaagggct gtggaactgt ttctgtgatt caggttacgt gtaa. It is sometimes possible for the material contained within the vial of "TTLL7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
