TTC39B cdna clone
TTC39B cDNA Clone
Gene Names
TTC39B; C9orf52
Synonyms
TTC39B; TTC39B cDNA Clone; TTC39B cdna clone
Sequence
atgacctttctctggggctgggctggggttcttcacagacaggtggacagcttgaagcagagaattgccgggaaatctatccctactgagaagtttgctgtgaggaaggctcggcgttactccgcctccttacctgcacctgtgaagctcatcttacctgccctggaaatgatgtatgtctggaatggtttttcaatagtgagcaaaagaaaagacctttctgaaaatctgttagtaactgttgaaaaagctgaggcagctttacaaagtcaaaattttaacagcttctctgtggatgatgagtgcttagtgaagttacttaaaggatgttgcctcaagaacttacagcggcccttgcaagctgaactatgttacaatcatgttgtggaaagtgaaaagctactgaagtatgaccactacctagtgccgttcactctatttgaattggcatctttgtataaaagccagggggaaattgacaaggccataaagttcctagaaactgcaaggaacaactacaaagattactccctggagtccagactacacttcagaattcaggcagctcttcacctctggagaaaaccttcctcagattga
Sequence Length
600
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
22,955 Da
NCBI Official Full Name
Homo sapiens tetratricopeptide repeat domain 39B, mRNA
NCBI Official Synonym Full Names
tetratricopeptide repeat domain 39B
NCBI Official Symbol
TTC39B
NCBI Official Synonym Symbols
C9orf52
NCBI Protein Information
tetratricopeptide repeat protein 39B
UniProt Protein Name
Tetratricopeptide repeat protein 39B
Protein Family
UniProt Gene Name
TTC39B
UniProt Synonym Gene Names
C9orf52; TPR repeat protein 39B
UniProt Entry Name
TT39B_HUMAN
Uniprot Description
TTC39B: Belongs to the TTC39 family. 7 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 9p22.3
Research Articles on TTC39B
Similar Products
Product Notes
The TTC39B ttc39b (Catalog #AAA1276545) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacctttc tctggggctg ggctggggtt cttcacagac aggtggacag cttgaagcag agaattgccg ggaaatctat ccctactgag aagtttgctg tgaggaaggc tcggcgttac tccgcctcct tacctgcacc tgtgaagctc atcttacctg ccctggaaat gatgtatgtc tggaatggtt tttcaatagt gagcaaaaga aaagaccttt ctgaaaatct gttagtaact gttgaaaaag ctgaggcagc tttacaaagt caaaatttta acagcttctc tgtggatgat gagtgcttag tgaagttact taaaggatgt tgcctcaaga acttacagcg gcccttgcaa gctgaactat gttacaatca tgttgtggaa agtgaaaagc tactgaagta tgaccactac ctagtgccgt tcactctatt tgaattggca tctttgtata aaagccaggg ggaaattgac aaggccataa agttcctaga aactgcaagg aacaactaca aagattactc cctggagtcc agactacact tcagaattca ggcagctctt cacctctgga gaaaaccttc ctcagattga. It is sometimes possible for the material contained within the vial of "TTC39B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
