TTC38 cdna clone
TTC38 cDNA Clone
Synonyms
TTC38; TTC38 cDNA Clone; TTC38 cdna clone
Sequence
atggccgcagcctcgcctctgcgcgactgccaggcctggaaggatgcgaggctcccgctctccaccacaagcaacgaagcctgcaagctgttcgatgccacgctgacccagtatgtaaaatggaccaatgacaagagtctcggtggcatcgagggctgcctgtcaaagctcaaagcagcagatccaacctttgtgatgggccacgccatggctactggccttgtgctgattggcactggaagctccgtgaagctggacaaagagctggacctggctgtgaagacaatggtggagatttcaagaacccagccgctgacaaggcgggagcagctgcacgtgtctgcagtagagacatttgccaatgggaactttccgaaagcctgtgaactatgggaacagattctccaggaccacccgacagacatgttggccctgaaattttcccatgatgcttatttttacctgggctatcaggaacagatgagagattctgttgctcgaatttaccccttctggacacctgacatccccctaagcagctatgtgaaaggcatctactcttttggcttgatggaaaccaacttctacgaccaggcagaaaaactcgccaaagaggctttatctattaacccgacagacgcatggtcggtgcacaccgtcgctcacatccacgagatgaaagcagagatcaaggatgggttggaattcatgcagcactcagagaccctctggaaggactctgatatgttggcttgtcataactattggcactgggctttatatctgattgagaagggcgaatatgaggccgcgctgaccatctacgatacccacatccttcccagcctgcaggccaacgatgcaatgctggacgtggtggacagctgctccatgctctaccgcctgcagatggaaggagtgtctgtgggccagcggtggcaggatgtcctgcctgtggcccggaagcacagccgagaccacatcctgctgttcaatgacgcacacttcctgatggcatccctgggtgcacacgacccccagaccacacaggagctgctgaccaccctgcgggacgccagcgaatccccaggggagaactgccagcacctcctggcccgagacgtggggctgcccctgtgccaggccctggtggaggctgaggacgggaaccctgaccgcgtcctggagctgctcctgcccatccgctaccggatcgtccagctcggtgggagcaatgcccagagagacgtcttcaaccagctgctgattcacgcggccttaaactgcacctccagcgtccataagaacgtagcccggagccttctgatggagcgtgatgccttgaagcccaactcgcccctgaccgagcggctcatccgcaaggcagctaccgtccacctcatgcagtga
Sequence Length
1410
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
52,787 Da
NCBI Official Full Name
Homo sapiens tetratricopeptide repeat domain 38, mRNA
UniProt Protein Name
Tetratricopeptide repeat protein 38
Protein Family
UniProt Gene Name
TTC38
UniProt Synonym Gene Names
TPR repeat protein 38
UniProt Entry Name
TTC38_HUMAN
Uniprot Description
TTC38: Belongs to the TTC38 family.
Chromosomal Location of Human Ortholog: 22q13
Similar Products
Product Notes
The TTC38 ttc38 (Catalog #AAA1274888) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcag cctcgcctct gcgcgactgc caggcctgga aggatgcgag gctcccgctc tccaccacaa gcaacgaagc ctgcaagctg ttcgatgcca cgctgaccca gtatgtaaaa tggaccaatg acaagagtct cggtggcatc gagggctgcc tgtcaaagct caaagcagca gatccaacct ttgtgatggg ccacgccatg gctactggcc ttgtgctgat tggcactgga agctccgtga agctggacaa agagctggac ctggctgtga agacaatggt ggagatttca agaacccagc cgctgacaag gcgggagcag ctgcacgtgt ctgcagtaga gacatttgcc aatgggaact ttccgaaagc ctgtgaacta tgggaacaga ttctccagga ccacccgaca gacatgttgg ccctgaaatt ttcccatgat gcttattttt acctgggcta tcaggaacag atgagagatt ctgttgctcg aatttacccc ttctggacac ctgacatccc cctaagcagc tatgtgaaag gcatctactc ttttggcttg atggaaacca acttctacga ccaggcagaa aaactcgcca aagaggcttt atctattaac ccgacagacg catggtcggt gcacaccgtc gctcacatcc acgagatgaa agcagagatc aaggatgggt tggaattcat gcagcactca gagaccctct ggaaggactc tgatatgttg gcttgtcata actattggca ctgggcttta tatctgattg agaagggcga atatgaggcc gcgctgacca tctacgatac ccacatcctt cccagcctgc aggccaacga tgcaatgctg gacgtggtgg acagctgctc catgctctac cgcctgcaga tggaaggagt gtctgtgggc cagcggtggc aggatgtcct gcctgtggcc cggaagcaca gccgagacca catcctgctg ttcaatgacg cacacttcct gatggcatcc ctgggtgcac acgaccccca gaccacacag gagctgctga ccaccctgcg ggacgccagc gaatccccag gggagaactg ccagcacctc ctggcccgag acgtggggct gcccctgtgc caggccctgg tggaggctga ggacgggaac cctgaccgcg tcctggagct gctcctgccc atccgctacc ggatcgtcca gctcggtggg agcaatgccc agagagacgt cttcaaccag ctgctgattc acgcggcctt aaactgcacc tccagcgtcc ataagaacgt agcccggagc cttctgatgg agcgtgatgc cttgaagccc aactcgcccc tgaccgagcg gctcatccgc aaggcagcta ccgtccacct catgcagtga. It is sometimes possible for the material contained within the vial of "TTC38, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
