TTC29 cdna clone
TTC29 cDNA Clone
Gene Names
TTC29; TBPP2A; NYD-SP14
Synonyms
TTC29; TTC29 cDNA Clone; TTC29 cdna clone
Sequence
atgaccaccctgcccccactgcccatgacacgcccgaagcttacagccttagccagacagaagctgccttgctcctccagaaaaattccaaggtctcaattgatcaaagaaaaagatgacatagatcattatctagaggtaaatttcaaaggattatcaaaagaggaagttgctgcttataggaactcctacaagaagaatatctgtgtggacatgctgcgagatggttatcataagtccttcaccgagctcttcgctctgatggagcggtgggatgccctgagggaggctgcgagagtcaggtccctcttctggctgcagaagcccctggaggagcagcctgataaactggattacctgtaccattacctgaccagggctgaggacgctgagaggaaagaatccttcgaagatgtatataataacttgtatgctctggcctgttacttcaataattctgaagacaagtgggtaaggaaccacttctatgaacgatgttttaagattgctcagctgatcaaaattgactgtgggaagaaagaagccgaggcacacatgcatatgggtcttctctacgaggaagatggtcagcttctggaagctgctgagcattatgaagcattccatcaattgacacaggggcggatatggaaggatgagacaggccgctctctcaacttgttggcctgtgagagtctcctgaggacttacagattactctcagacaaaatgctagaaaataaagaatacaaacaggccatcaaaattctaataaaagcttctgaaatagccaaagaaggaagtgacaaaaagatggaagcggaaacctcttactacttgggcttagcacacttagctgctgaggaatatgaaacagcattaacagtccttgacacttactgtaaatctccacagacctggatgatgatctcagtctggggagaggctatgaagccatag
Sequence Length
960
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
57,846 Da
NCBI Official Full Name
Homo sapiens tetratricopeptide repeat domain 29, mRNA
NCBI Official Synonym Full Names
tetratricopeptide repeat domain 29
NCBI Official Symbol
TTC29
NCBI Official Synonym Symbols
TBPP2A; NYD-SP14
NCBI Protein Information
tetratricopeptide repeat protein 29
UniProt Protein Name
Tetratricopeptide repeat protein 29
Protein Family
UniProt Gene Name
TTC29
UniProt Synonym Gene Names
TPR repeat protein 29
UniProt Entry Name
TTC29_HUMAN
Uniprot Description
TTC29: 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 4q31.22
Research Articles on TTC29
Similar Products
Product Notes
The TTC29 ttc29 (Catalog #AAA1269997) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccaccc tgcccccact gcccatgaca cgcccgaagc ttacagcctt agccagacag aagctgcctt gctcctccag aaaaattcca aggtctcaat tgatcaaaga aaaagatgac atagatcatt atctagaggt aaatttcaaa ggattatcaa aagaggaagt tgctgcttat aggaactcct acaagaagaa tatctgtgtg gacatgctgc gagatggtta tcataagtcc ttcaccgagc tcttcgctct gatggagcgg tgggatgccc tgagggaggc tgcgagagtc aggtccctct tctggctgca gaagcccctg gaggagcagc ctgataaact ggattacctg taccattacc tgaccagggc tgaggacgct gagaggaaag aatccttcga agatgtatat aataacttgt atgctctggc ctgttacttc aataattctg aagacaagtg ggtaaggaac cacttctatg aacgatgttt taagattgct cagctgatca aaattgactg tgggaagaaa gaagccgagg cacacatgca tatgggtctt ctctacgagg aagatggtca gcttctggaa gctgctgagc attatgaagc attccatcaa ttgacacagg ggcggatatg gaaggatgag acaggccgct ctctcaactt gttggcctgt gagagtctcc tgaggactta cagattactc tcagacaaaa tgctagaaaa taaagaatac aaacaggcca tcaaaattct aataaaagct tctgaaatag ccaaagaagg aagtgacaaa aagatggaag cggaaacctc ttactacttg ggcttagcac acttagctgc tgaggaatat gaaacagcat taacagtcct tgacacttac tgtaaatctc cacagacctg gatgatgatc tcagtctggg gagaggctat gaagccatag. It is sometimes possible for the material contained within the vial of "TTC29, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
