Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TSEN2 cdna clone

TSEN2 cDNA Clone

Gene Names
TSEN2; SEN2; PCH2B; SEN2L
Synonyms
TSEN2; TSEN2 cDNA Clone; TSEN2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagaagcagttttccatgccccaaagaggaaaagaagagtgtatgagacttacgagtctccattgccaatcccttttggtcaggaccatggtcctctgaaagaattcaagatattccgtgctgaaatgattaacaacaatgtgattgtgaggaatgcggaggacattgagcagctctatgggaaaggttattttggaaaaggtattctttcaagaagccgtccaagcttcacaatttcagatcctaaactggttgctaaatggaaagatatgaagacaaacatgcctatcatcacatcaaagaggtatcagcatagtgttgagtgggcagcagagctgatgcgtagacaggggcaggatgagagtacagtgcgcagaatcctcaaggattacacgaaaccgcttgagcatcctcctgtgaaaaggaatgaagaggctcaagtgcatgacaagcttaactctggaatggtttccaacatggaaggcacagcagggggagagagaccttctgtggtaaacggggactctggaaagtcaggtggtgtgggtgatccccgtgagccattaggctgcctgcaggagggctctggctgccacccaacaacagagagctttgagaaaagcgtgcgagaggatgcctcacctctgccccatgtctgttgctgcaaacaagatgctctcatcctccagcgtggccttcatcatgaagacggcagccagcacatcggcctcctgcatcctggggacagagggcctgaccatgagtacgtgctggtcgaggaagcggagtgtgccatgagcgagagggaggctgccccaaatgaggaattggtgcaaagaaacaggttaatatgcagaagaaatccatataggatctttgagtatttgcaactcagcctagaagaggcctttttcttggtctatgctctgggatgtttaagtatttactatgagaaggagcctttaacgatagtgaagctctggaaagctttcactgtagttcagcccacgttcagaaccacctacatggcctaccattactttcgaagcaagggctgggtgcccaaagtgggactcaagtacgggacagatttactgctatatcggaaaggccctccattttaccatgcaagttattctgtcattatcgagctagttgatgaccattttgaaggctctctccgcaggcctctcagttggaagtccctggctgccttgagcagagtttccgttaatgtctctaaggaacttatgctgtgctatttgattaaaccctctactatgactgacaaggaaatggagtcaccagaatgtatgaaaaggattaaagttcaggaggtgattctgagtcgatgggtttcttcacgagagaggagtgaccaagacgatctttaa
Sequence Length
1398
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,532 Da
NCBI Official Full Name
Homo sapiens tRNA splicing endonuclease 2 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
tRNA splicing endonuclease subunit 2
NCBI Official Symbol
TSEN2
NCBI Official Synonym Symbols
SEN2; PCH2B; SEN2L
NCBI Protein Information
tRNA-splicing endonuclease subunit Sen2
UniProt Protein Name
tRNA-splicing endonuclease subunit Sen2
UniProt Gene Name
TSEN2
UniProt Synonym Gene Names
SEN2; HsSen2
UniProt Entry Name
SEN2_HUMAN

NCBI Description

This gene encodes one of the subunits of the tRNA splicing endonuclease. This endonuclease catalyzes the first step in RNA splicing which is the removal of introns. Mutations in this gene have been associated with pontocerebellar hypoplasia type 2. A pseudogene has been identified on chromosome 4. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]

Uniprot Description

SEN2: Constitutes one of the two catalytic subunit of the tRNA-splicing endonuclease complex, a complex responsible for identification and cleavage of the splice sites in pre-tRNA. It cleaves pre-tRNA at the 5'- and 3'-splice sites to release the intron. The products are an intron and two tRNA half-molecules bearing 2',3'-cyclic phosphate and 5'-OH termini. There are no conserved sequences at the splice sites, but the intron is invariably located at the same site in the gene, placing the splice sites an invariant distance from the constant structural features of the tRNA body. Isoform 1 probably carries the active site for 5'-splice site cleavage. The tRNA splicing endonuclease is also involved in mRNA processing via its association with pre- mRNA 3'-end processing factors, establishing a link between pre- tRNA splicing and pre-mRNA 3'-end formation, suggesting that the endonuclease subunits function in multiple RNA-processing events. Isoform 2 is responsible for processing a yet unknown RNA substrate. The complex containing isoform 2 is not able to cleave pre-tRNAs properly, although it retains endonucleolytic activity. Defects in TSEN2 are the cause of pontocerebellar hypoplasia type 2B (PCH2B). Pontocerebellar hypoplasia (PCH) is a heterogeneous group of disorders characterized by an abnormally small cerebellum and brainstem. PCH type 2 is characterized by progressive microcephaly from birth combined with extrapyramidal dyskinesia and chorea, epilepsy, and normal spinal cord findings. Belongs to the tRNA-intron endonuclease family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 4.6.1.16; RNA processing; Ribonuclease; Nucleolus

Chromosomal Location of Human Ortholog: 3p25.2

Cellular Component: centrosome; cytoplasm; nucleoplasm; tRNA-intron endonuclease complex

Molecular Function: protein binding; tRNA-intron endonuclease activity

Biological Process: tRNA splicing; tRNA-type intron splice site recognition and cleavage

Disease: Pontocerebellar Hypoplasia, Type 2b

Similar Products

Product Notes

The TSEN2 tsen2 (Catalog #AAA1266088) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaag cagttttcca tgccccaaag aggaaaagaa gagtgtatga gacttacgag tctccattgc caatcccttt tggtcaggac catggtcctc tgaaagaatt caagatattc cgtgctgaaa tgattaacaa caatgtgatt gtgaggaatg cggaggacat tgagcagctc tatgggaaag gttattttgg aaaaggtatt ctttcaagaa gccgtccaag cttcacaatt tcagatccta aactggttgc taaatggaaa gatatgaaga caaacatgcc tatcatcaca tcaaagaggt atcagcatag tgttgagtgg gcagcagagc tgatgcgtag acaggggcag gatgagagta cagtgcgcag aatcctcaag gattacacga aaccgcttga gcatcctcct gtgaaaagga atgaagaggc tcaagtgcat gacaagctta actctggaat ggtttccaac atggaaggca cagcaggggg agagagacct tctgtggtaa acggggactc tggaaagtca ggtggtgtgg gtgatccccg tgagccatta ggctgcctgc aggagggctc tggctgccac ccaacaacag agagctttga gaaaagcgtg cgagaggatg cctcacctct gccccatgtc tgttgctgca aacaagatgc tctcatcctc cagcgtggcc ttcatcatga agacggcagc cagcacatcg gcctcctgca tcctggggac agagggcctg accatgagta cgtgctggtc gaggaagcgg agtgtgccat gagcgagagg gaggctgccc caaatgagga attggtgcaa agaaacaggt taatatgcag aagaaatcca tataggatct ttgagtattt gcaactcagc ctagaagagg cctttttctt ggtctatgct ctgggatgtt taagtattta ctatgagaag gagcctttaa cgatagtgaa gctctggaaa gctttcactg tagttcagcc cacgttcaga accacctaca tggcctacca ttactttcga agcaagggct gggtgcccaa agtgggactc aagtacggga cagatttact gctatatcgg aaaggccctc cattttacca tgcaagttat tctgtcatta tcgagctagt tgatgaccat tttgaaggct ctctccgcag gcctctcagt tggaagtccc tggctgcctt gagcagagtt tccgttaatg tctctaagga acttatgctg tgctatttga ttaaaccctc tactatgact gacaaggaaa tggagtcacc agaatgtatg aaaaggatta aagttcagga ggtgattctg agtcgatggg tttcttcacg agagaggagt gaccaagacg atctttaa. It is sometimes possible for the material contained within the vial of "TSEN2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.