TRUB1 cdna clone
TRUB1 cDNA Clone
Gene Names
TRUB1; PUS4
Synonyms
TRUB1; TRUB1 cDNA Clone; TRUB1 cdna clone
Sequence
atggccgcttctgaggcggcggtggtgtcttcgccgtctttgaaaacagacacatcccctgtccttgaaactgcaggaacggtcgcagcaatggctgcgaccccgtcagcaagggctgcagccgcggtggttgcggccgcggccaggaccggatccgaagccagggtctccaaggccgctttggctaccaagctgctgtccttgagcggcgtgttcgccgtgcacaagcccaaagggcccacttcagccgagctgctgaatcggttgaaggagaagctgctggcagaagctggaatgccttctccagaatggaccaagaggaaaaagcagactttgaaaattgggcatggagggactctagacagcgcagcccgaggagttctggttgttggaattggaagcggaacaaaaatgttgaccagtatgttgtcagggtccaagagatatactgccattggagaactggggaaagctactgatacactagattctacggggagggtaacagaagaaaaaccttacgataaaataacacaagaagatattgaaggcattctacagaaatttactggaaatataatgcaagtgccccccctctattctgcattaaagaaagatggacaaagactttcgactttgatgaagagaggtgaagtcgtagaagcaaaacctgccaggccagtgactgtatacagtatctcccttcaaaaattccagccaccatttttcacattagatgttgaatgtggaggaggtttttatatcagaagcttggtcagtgacattggaaaagaactatcttcctgtgccaatgtgctagagctgacccgaaccaaacagggaccatttacgctagaagaacatgcccttcctgaagacaaatggacaattgatgacattgcacagtctcttgagcattgctcatctcttttcccagcagagttggcacttaaaaaatcaaaacctgagtctaatgaacaggttttgagctgtgaatatataactctaaatgagccaaagagagaagatgatgtaattaagacgtgttga
Sequence Length
1050
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,253 Da
NCBI Official Full Name
Homo sapiens TruB pseudouridine (psi) synthase homolog 1 (E. coli), mRNA
NCBI Official Synonym Full Names
TruB pseudouridine synthase family member 1
NCBI Official Symbol
TRUB1
NCBI Official Synonym Symbols
PUS4
NCBI Protein Information
probable tRNA pseudouridine synthase 1
UniProt Protein Name
Probable tRNA pseudouridine synthase 1
Protein Family
UniProt Gene Name
TRUB1
UniProt Synonym Gene Names
PUS4
UniProt Entry Name
TRUB1_HUMAN
NCBI Description
Pseudouridine is an abundant component of rRNAs and tRNAs and is enzymatically generated by isomerization of uridine by pseudouridine synthase (Zucchini et al., 2003 [PubMed 12736709]).[supplied by OMIM, Mar 2008]
Uniprot Description
TRUB1: May be responsible for synthesis of pseudouridine from uracil in transfer RNAs. Belongs to the pseudouridine synthase TruB family.
Protein type: RNA processing; EC 5.4.99.-; Isomerase
Chromosomal Location of Human Ortholog: 10q25.3
Molecular Function: pseudouridine synthase activity
Biological Process: tRNA modification
Research Articles on TRUB1
Similar Products
Product Notes
The TRUB1 trub1 (Catalog #AAA1267081) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgctt ctgaggcggc ggtggtgtct tcgccgtctt tgaaaacaga cacatcccct gtccttgaaa ctgcaggaac ggtcgcagca atggctgcga ccccgtcagc aagggctgca gccgcggtgg ttgcggccgc ggccaggacc ggatccgaag ccagggtctc caaggccgct ttggctacca agctgctgtc cttgagcggc gtgttcgccg tgcacaagcc caaagggccc acttcagccg agctgctgaa tcggttgaag gagaagctgc tggcagaagc tggaatgcct tctccagaat ggaccaagag gaaaaagcag actttgaaaa ttgggcatgg agggactcta gacagcgcag cccgaggagt tctggttgtt ggaattggaa gcggaacaaa aatgttgacc agtatgttgt cagggtccaa gagatatact gccattggag aactggggaa agctactgat acactagatt ctacggggag ggtaacagaa gaaaaacctt acgataaaat aacacaagaa gatattgaag gcattctaca gaaatttact ggaaatataa tgcaagtgcc ccccctctat tctgcattaa agaaagatgg acaaagactt tcgactttga tgaagagagg tgaagtcgta gaagcaaaac ctgccaggcc agtgactgta tacagtatct cccttcaaaa attccagcca ccatttttca cattagatgt tgaatgtgga ggaggttttt atatcagaag cttggtcagt gacattggaa aagaactatc ttcctgtgcc aatgtgctag agctgacccg aaccaaacag ggaccattta cgctagaaga acatgccctt cctgaagaca aatggacaat tgatgacatt gcacagtctc ttgagcattg ctcatctctt ttcccagcag agttggcact taaaaaatca aaacctgagt ctaatgaaca ggttttgagc tgtgaatata taactctaaa tgagccaaag agagaagatg atgtaattaa gacgtgttga. It is sometimes possible for the material contained within the vial of "TRUB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
