Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRMU cdna clone

TRMU cDNA Clone

Gene Names
TRMU; MTO2; MTU1; TRMT; LCAL3; TRMT1; TRNT1
Synonyms
TRMU; TRMU cDNA Clone; TRMU cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaagtctttgagcagaagcacgttaagaagcccgaatggcttttcagaaatcggtttgaagttagaaatggtttcccaggatgccctgaggagaaccatcttccctctggggggattaacgaaagagtttgtaaagaaaatcgctgctgagaatagacttcatcatgtgcttcagaagaaagagagcatgggcatgtgtttcatcgggaagaggaattttgaacatttccttcttcagtatctgcagcctcgacctggtcactttatttccatagaagacaataaggttctgggaacacataaaggttggttcctgtataccttgggccagagagcaaacataggtggcctgagagagccctggtacgtggtggagaaggacagcgtcaagggtgacgtgtttgtggccccccggacagaccacccagccctgtacagggacctgctgaggaccagccgcgtgcactggattgcggaggagcctcccgcagcactggtccgggacaagatgatggagtgccacttccgattccgccaccagatggcactagtttgctgtgttctacaagggggacgagtgcctgggcagcgggaagatcctgcggctggggccgtctgcctacacgctccagaagggccagcgcagagctgggatggccactga
Sequence Length
669
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,154 Da
NCBI Official Full Name
Homo sapiens tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase, mRNA
NCBI Official Synonym Full Names
tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
NCBI Official Symbol
TRMU
NCBI Official Synonym Symbols
MTO2; MTU1; TRMT; LCAL3; TRMT1; TRNT1
NCBI Protein Information
mitochondrial tRNA-specific 2-thiouridylase 1
UniProt Protein Name
Mitochondrial tRNA-specific 2-thiouridylase 1
UniProt Gene Name
TRMU
UniProt Synonym Gene Names
MTU1; TRMT1
UniProt Entry Name
MTU1_HUMAN

NCBI Description

This nuclear gene encodes a mitochondrial tRNA-modifying enzyme. The encoded protein catalyzes the 2-thiolation of uridine on the wobble positions of tRNA(Lys), tRNA(Glu), and tRNA(Gln), resulting in the formation of 5-taurinomethyl-2-thiouridine moieties. Mutations in this gene may cause transient infantile liver failure. Polymorphisms in this gene may also influence the severity of deafness caused by mitochondrial 12S ribosomal RNA mutations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Uniprot Description

TRMU: Catalyzes the 2-thiolation of uridine at the wobble position (U34) of mitochondrial tRNA(Lys), tRNA(Glu) and tRNA(Gln). Required for the formation of 5-taurinomethyl-2- thiouridine (tm5s2U) of mitochondrial tRNA(Lys), tRNA(Glu), and tRNA(Gln) at the wobble position. ATP is required to activate the C2 atom of the wobble base. Defects in TRMU are a cause of transient infantile liver failure (LFIT). A transient disorder of hepatic function characterized by elevated liver enzymes, jaundice, vomiting, coagulopathy, hyperbilirubinemia, increased serum lactate. Patients who survive the initial acute episode can recover, show normal development and have no recurrence. Belongs to the MnmA/TRMU family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Transferase; EC 2.8.1.-; Mitochondrial

Chromosomal Location of Human Ortholog: 22q13

Cellular Component: mitochondrion; nucleoplasm

Disease: Deafness, Aminoglycoside-induced; Liver Failure, Infantile, Transient

Research Articles on TRMU

Similar Products

Product Notes

The TRMU trmu (Catalog #AAA1274654) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaagt ctttgagcag aagcacgtta agaagcccga atggcttttc agaaatcggt ttgaagttag aaatggtttc ccaggatgcc ctgaggagaa ccatcttccc tctgggggga ttaacgaaag agtttgtaaa gaaaatcgct gctgagaata gacttcatca tgtgcttcag aagaaagaga gcatgggcat gtgtttcatc gggaagagga attttgaaca tttccttctt cagtatctgc agcctcgacc tggtcacttt atttccatag aagacaataa ggttctggga acacataaag gttggttcct gtataccttg ggccagagag caaacatagg tggcctgaga gagccctggt acgtggtgga gaaggacagc gtcaagggtg acgtgtttgt ggccccccgg acagaccacc cagccctgta cagggacctg ctgaggacca gccgcgtgca ctggattgcg gaggagcctc ccgcagcact ggtccgggac aagatgatgg agtgccactt ccgattccgc caccagatgg cactagtttg ctgtgttcta caagggggac gagtgcctgg gcagcgggaa gatcctgcgg ctggggccgt ctgcctacac gctccagaag ggccagcgca gagctgggat ggccactga. It is sometimes possible for the material contained within the vial of "TRMU, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.