Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIML1 cdna clone

TRIML1 cDNA Clone

Gene Names
TRIML1; RNF209
Synonyms
TRIML1; TRIML1 cDNA Clone; TRIML1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggagatgctaagaaaattcagcacggagataacgctggacccagccacagctaatgcctatctcgtgttgtcggaggatctgaagagtgtgaaatatgggggaagcagacagcagctacccgacaacccggaaagatttgaccagtctgcgactgtgctgggtactcagatcttcaccagtgggagacactactgggaggtggaggtgggaaacaagaccgagtgggaagtgggcatctgcaaggactctgtgagcagaaaggggaatctccccaagccacctggggacctgttctcactaataggtttaaaaatcggagatgattacagcctctgggtctcgtcacctttgaaaggtcagcacgtcagagagcctgtgtgtaaggttggtgtcttcctggactatgaatctggacatatagcattctacaacgggacggatgaatccctcatctacagcttcccgcaggcttctttccaagaggccctcaggcctatcttttccccctgcctcccaaatgaggggacaaacacagaccctctcaccatctgctcactgaacagccacgtctga
Sequence Length
579
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,002 Da
NCBI Official Full Name
Homo sapiens tripartite motif family-like 1, mRNA
NCBI Official Synonym Full Names
tripartite motif family like 1
NCBI Official Symbol
TRIML1
NCBI Official Synonym Symbols
RNF209
NCBI Protein Information
probable E3 ubiquitin-protein ligase TRIML1
UniProt Protein Name
Probable E3 ubiquitin-protein ligase TRIML1
UniProt Gene Name
TRIML1
UniProt Synonym Gene Names
RNF209
UniProt Entry Name
TRIML_HUMAN

Uniprot Description

TRIML1: Probable E3 ubiquitin-protein ligase which plays an important role in blastocyst development.

Protein type: Ubiquitin conjugating system; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 4q35.2

Similar Products

Product Notes

The TRIML1 triml1 (Catalog #AAA1273391) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggaga tgctaagaaa attcagcacg gagataacgc tggacccagc cacagctaat gcctatctcg tgttgtcgga ggatctgaag agtgtgaaat atgggggaag cagacagcag ctacccgaca acccggaaag atttgaccag tctgcgactg tgctgggtac tcagatcttc accagtggga gacactactg ggaggtggag gtgggaaaca agaccgagtg ggaagtgggc atctgcaagg actctgtgag cagaaagggg aatctcccca agccacctgg ggacctgttc tcactaatag gtttaaaaat cggagatgat tacagcctct gggtctcgtc acctttgaaa ggtcagcacg tcagagagcc tgtgtgtaag gttggtgtct tcctggacta tgaatctgga catatagcat tctacaacgg gacggatgaa tccctcatct acagcttccc gcaggcttct ttccaagagg ccctcaggcc tatcttttcc ccctgcctcc caaatgaggg gacaaacaca gaccctctca ccatctgctc actgaacagc cacgtctga. It is sometimes possible for the material contained within the vial of "TRIML1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.